ID: 1138657958

View in Genome Browser
Species Human (GRCh38)
Location 16:58501483-58501505
Sequence TCTGAGGCCCCCAACCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138657958_1138657963 3 Left 1138657958 16:58501483-58501505 CCCTGAGGGTTGGGGGCCTCAGA 0: 1
1: 0
2: 3
3: 21
4: 243
Right 1138657963 16:58501509-58501531 CACCGCGCTGTGGCCCTTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 73
1138657958_1138657969 29 Left 1138657958 16:58501483-58501505 CCCTGAGGGTTGGGGGCCTCAGA 0: 1
1: 0
2: 3
3: 21
4: 243
Right 1138657969 16:58501535-58501557 GCCCTTGCGCAGCGCTCCAAGGG 0: 1
1: 0
2: 0
3: 2
4: 31
1138657958_1138657964 4 Left 1138657958 16:58501483-58501505 CCCTGAGGGTTGGGGGCCTCAGA 0: 1
1: 0
2: 3
3: 21
4: 243
Right 1138657964 16:58501510-58501532 ACCGCGCTGTGGCCCTTGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1138657958_1138657962 2 Left 1138657958 16:58501483-58501505 CCCTGAGGGTTGGGGGCCTCAGA 0: 1
1: 0
2: 3
3: 21
4: 243
Right 1138657962 16:58501508-58501530 GCACCGCGCTGTGGCCCTTGTGG 0: 1
1: 0
2: 0
3: 7
4: 99
1138657958_1138657961 -7 Left 1138657958 16:58501483-58501505 CCCTGAGGGTTGGGGGCCTCAGA 0: 1
1: 0
2: 3
3: 21
4: 243
Right 1138657961 16:58501499-58501521 CCTCAGAGTGCACCGCGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 98
1138657958_1138657968 28 Left 1138657958 16:58501483-58501505 CCCTGAGGGTTGGGGGCCTCAGA 0: 1
1: 0
2: 3
3: 21
4: 243
Right 1138657968 16:58501534-58501556 TGCCCTTGCGCAGCGCTCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138657958 Original CRISPR TCTGAGGCCCCCAACCCTCA GGG (reversed) Intronic
900339479 1:2181211-2181233 TCTGTGGCCCCCAGCGCACAAGG + Intronic
900412707 1:2520144-2520166 GCTGGGACACCCAACCCTCAGGG + Intronic
900512125 1:3065692-3065714 TAGGAGGCCCCCAAGCCCCAGGG - Intergenic
901617794 1:10555675-10555697 ACTGCGGCCCCTCACCCTCACGG - Intronic
901664302 1:10817686-10817708 TCTGAGGGCTCCAGTCCTCAGGG - Intergenic
902720861 1:18303074-18303096 CCTGGGGCCCCCAACCACCAAGG + Intronic
902786706 1:18737250-18737272 GGTGAGGCCCCCATCCCTGAGGG + Intronic
902879644 1:19362883-19362905 TCTGAGGCCCCCCCACTTCATGG - Intronic
903067783 1:20710426-20710448 CCAGAGGCCCCCAGCCCTCAGGG + Intronic
903787480 1:25871081-25871103 CCTGAGGCCCCCAAATCTAATGG - Exonic
905172344 1:36116532-36116554 TCTGATGCCCCCAGCCCTTCAGG - Intronic
905388792 1:37623096-37623118 TCTGAGCCCCCAAACCCTCATGG - Intronic
905626846 1:39495075-39495097 TCTGGGGCCACCAACCTTCAGGG - Intronic
905822704 1:41006209-41006231 TCTGAGTGCCCAAAACCTCAGGG - Intronic
913112330 1:115667545-115667567 GTTGAGGTCCCCAACCCCCAGGG + Intronic
913191993 1:116420711-116420733 TCTGAGGCTCCCTACCCATAGGG - Intergenic
914005957 1:143732397-143732419 TCAGGGGTCCCCAACCCCCAGGG - Intergenic
914098426 1:144563630-144563652 TCAGGGGTCCCCAACCCCCAGGG - Intergenic
914300556 1:146374012-146374034 TCAGGGGTCCCCAACCCCCAGGG + Intergenic
915245535 1:154553594-154553616 TCTCAGGGCCCCAAGCCTAAAGG + Intronic
915853265 1:159351372-159351394 TCTGAGTCCCACAGCCCTCCAGG - Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
917644610 1:177017920-177017942 TCTGAGGACCCCTAGCTTCAAGG - Intronic
918534288 1:185557356-185557378 TCTGAGTCCCCTAAGGCTCATGG + Intergenic
920181651 1:204135513-204135535 TGTGAGTCCCCCAACCCTTGTGG + Intronic
920207982 1:204306943-204306965 TCTGCAGCCCCCTACCCCCAAGG + Intronic
921131540 1:212224135-212224157 TCTAAGTCCCCCAACCAGCAAGG - Intergenic
922995851 1:229960294-229960316 TCTGAGGCTACCAAAACTCATGG + Intergenic
923181383 1:231523238-231523260 TATGAGGCCACCAATCCTAATGG + Intergenic
924396461 1:243626401-243626423 TCTTAGTCCCCCAACACTGAAGG + Intronic
1062944075 10:1446872-1446894 TCTGAGGCCATCAACCCTCCCGG - Intronic
1064978411 10:21142660-21142682 TCAGGGGCCCCCAACCCCCAGGG + Intronic
1066987798 10:42483567-42483589 TCTCAGCCCCCCACCACTCAAGG - Intergenic
1068957090 10:62827979-62828001 TCAGGGGTCCCCAACCCCCAGGG + Intronic
1069709270 10:70478675-70478697 TCTGAGCCCCCCGCCCCTCGCGG + Intergenic
1069719278 10:70539448-70539470 CCTGACCCCCCCAAGCCTCAGGG - Intronic
1070458609 10:76642733-76642755 TCTGAGGCCCCAAATCCAAATGG - Intergenic
1071267967 10:83981265-83981287 ACTGAAGCCCCAAACCCACAAGG + Intergenic
1071302509 10:84266751-84266773 TCTCAGGCCCTCAAGTCTCAGGG + Intergenic
1072524934 10:96263335-96263357 TCTGGGGCCCCCAGCCAGCATGG + Intronic
1073414326 10:103368461-103368483 CCTGCGGCCCCCGACCCTCCGGG + Exonic
1076790760 10:132775539-132775561 CCTGTGGCCCCCAACACCCAGGG - Intronic
1076880442 10:133237024-133237046 ACTGTGGCGCCCAAACCTCACGG - Intergenic
1077014312 11:393129-393151 TCTGAGGCCCTCTAGCCTCTGGG - Intronic
1077029306 11:456716-456738 TCTTAGGCCCCCATTCCTAAGGG - Intronic
1077045726 11:544451-544473 CCTGAGCCCCCAAAGCCTCACGG - Intronic
1077102549 11:828589-828611 GCTGAGGCCCCCTGCTCTCATGG + Exonic
1077121306 11:910247-910269 TCTGATGCGCCCACCCTTCACGG + Intronic
1077508626 11:2943703-2943725 TCTCAGGCTCCCCAGCCTCAGGG - Intergenic
1077674057 11:4181973-4181995 TCTGGGGCGCCGAACCCTGAGGG - Intergenic
1079141100 11:17810184-17810206 TCTGAGGGCCCTAATCCTCAGGG - Intronic
1081137015 11:39451030-39451052 TCTGAGCCCTCCAAGCCTCTAGG + Intergenic
1081735425 11:45400180-45400202 TGTGAGGCCCTCACTCCTCAAGG + Intergenic
1082780993 11:57287310-57287332 TCTCAGGCCCACAGCCCCCAGGG - Intergenic
1083367331 11:62149239-62149261 TTCCAGGCCCCCAACCCCCATGG + Intronic
1083692180 11:64416210-64416232 CCTGTGGCCACGAACCCTCATGG - Intergenic
1084268363 11:68016488-68016510 GCTGAGGCCCCAAGCCTTCAGGG - Intronic
1084601302 11:70147405-70147427 CAGGAGGCCCCCAACCCCCAGGG - Intronic
1084794485 11:71496056-71496078 TCTGAGTCCCCCACACTTCAGGG + Intronic
1085396199 11:76208382-76208404 TCTGAGACCCCCAGCCTTGACGG - Intronic
1089613084 11:119680523-119680545 TCTGAGGGCCCCAAAACCCATGG + Intronic
1090272828 11:125399847-125399869 TCTCAGACCTCCAACCCTGAGGG - Intronic
1090445690 11:126762992-126763014 TCAGAGGCCACCCATCCTCAGGG + Intronic
1092916599 12:13194862-13194884 TCTGAGCATCCCAACCCTCAGGG - Intergenic
1095225564 12:39672987-39673009 TTGGAGTCCCTCAACCCTCATGG - Intronic
1096573098 12:52535140-52535162 TCTGGGATCCACAACCCTCAGGG + Intergenic
1097278644 12:57830564-57830586 TTTAAGGCCCCCTCCCCTCAAGG + Intronic
1097693776 12:62758289-62758311 TTTGAGGCCACCAGACCTCAAGG - Intronic
1098097887 12:66979495-66979517 TCTGAGGGCTCCAAGCCTCAGGG + Intergenic
1098437349 12:70481984-70482006 TCTCAGGGCCCCAGCACTCAAGG - Intergenic
1100707576 12:97218768-97218790 TCTGAGTCCCCCAAGGGTCAAGG - Intergenic
1101530145 12:105566447-105566469 TCAGAAACCCCCCACCCTCAGGG + Intergenic
1101798504 12:108000452-108000474 TCTGAGACACCCCACCCTCTAGG - Intergenic
1103054782 12:117810066-117810088 GCTGAGGCCCCCAGCCCTCAAGG + Intronic
1103264438 12:119617190-119617212 TCTGAGGCCTCCAAGTCTCTAGG - Intronic
1103344874 12:120242502-120242524 TCTCAGGCCTCAAACCCTCATGG + Intronic
1106494971 13:30267822-30267844 TCTGAGGCCCAAAACACTGAAGG - Intronic
1108829046 13:54453749-54453771 TCTGAGCCCTCCAACTCTCTAGG + Intergenic
1109602338 13:64648346-64648368 TCTCAGTCTCCCAACCCTAATGG - Intergenic
1110233171 13:73187879-73187901 GATGAGGCCCCCCAACCTCACGG - Intergenic
1112642866 13:101296748-101296770 TCTCAGACCCCAAACTCTCAAGG + Intronic
1113465539 13:110510205-110510227 TCTGGGGCCACCCATCCTCACGG - Intronic
1113958684 13:114113252-114113274 TCTGAGGCCCCCAGTCTCCATGG - Intronic
1115636190 14:35292287-35292309 TCTGAGGCCCCGCCCCCTAAGGG - Intronic
1119226140 14:72945967-72945989 TCTGAAGACCCCTACGCTCAAGG + Exonic
1119774344 14:77239310-77239332 GCTGAGCCACCCAGCCCTCAGGG + Intronic
1121020719 14:90578582-90578604 TCTGAGGGCACCCACCCTCAGGG + Intronic
1121128686 14:91426128-91426150 TCTGAGCCCTCCAACTCTCTAGG - Intergenic
1122113913 14:99518330-99518352 TCCCAGGCCCCCTAGCCTCAGGG - Intronic
1122767240 14:104081113-104081135 CCTGAGGCCCCCCAGCCTCAGGG + Intergenic
1122861586 14:104584993-104585015 TCTGAGGCACCCATCCCTTTGGG + Intronic
1122983722 14:105202840-105202862 CCTGAAGCCCCCAAGGCTCAGGG + Intergenic
1125296344 15:38207672-38207694 CCTGAGACCCCTACCCCTCAGGG + Intergenic
1125510216 15:40288697-40288719 TCTGATGCCCCCATCCCACTGGG - Exonic
1125524221 15:40365094-40365116 TCTGAGTCTTCCAACCCTAATGG + Intronic
1125769831 15:42157757-42157779 TCTGTGGACCACAACCATCAAGG + Intergenic
1129361942 15:75029760-75029782 GCAGAGGCCTCCCACCCTCACGG - Intronic
1129693202 15:77725202-77725224 ACTGAAACCCCCAACCCCCATGG - Intronic
1130162471 15:81415022-81415044 AATGAAGCCGCCAACCCTCATGG - Intergenic
1130196684 15:81785945-81785967 TCTCAGGCCTCCAATCCTCTAGG - Intergenic
1130715434 15:86329277-86329299 CCTGAGCCACCCCACCCTCATGG + Intronic
1131857886 15:96618002-96618024 TCTGAAGACCCTAACCCTCAAGG - Intergenic
1132401529 15:101510707-101510729 TCTCAGCCCAGCAACCCTCAAGG - Intronic
1133038594 16:3047659-3047681 TCTCAGGCCCCAAACCCAGAGGG + Intronic
1136642284 16:31577089-31577111 TCTGAGGCCTCCAAGTCTCTAGG - Intergenic
1137798488 16:51241441-51241463 TTTGATGCCTCCAAACCTCATGG - Intergenic
1138388126 16:56650430-56650452 TGTGAGGGCCCCATTCCTCATGG - Intronic
1138657958 16:58501483-58501505 TCTGAGGCCCCCAACCCTCAGGG - Intronic
1139920214 16:70454898-70454920 TCTGAGGCCCGCATCCCTCCCGG - Intronic
1140376771 16:74451126-74451148 TCAGCGGCCCCCAGCCCCCAGGG + Intergenic
1140472301 16:75222720-75222742 GCTGAGGCCCCAAACCCACCTGG - Intronic
1142396899 16:89837260-89837282 AGTGAGGCACCCCACCCTCAGGG + Intronic
1142806461 17:2373529-2373551 CCCGAGACCCCCAACCCTCCAGG - Intronic
1143024952 17:3936046-3936068 TCTCAGGCCCACGTCCCTCATGG - Intronic
1143100651 17:4502969-4502991 TCTGAGGCCTGCTGCCCTCAGGG - Intronic
1143205280 17:5136538-5136560 GCAGAGGCCCCCAAACCCCAAGG - Intronic
1144259727 17:13506626-13506648 TCTGCTGCCCCCAAGCCTTAGGG - Intronic
1144876328 17:18399231-18399253 GCAGAGGCCCCCAAACCTGAAGG - Intergenic
1146415384 17:32627370-32627392 TCTAAAGCACCCTACCCTCATGG - Intronic
1148160476 17:45447160-45447182 GTTTAGTCCCCCAACCCTCAAGG - Intronic
1150391765 17:64794040-64794062 GTTTAGTCCCCCAACCCTCAAGG - Intergenic
1150491719 17:65578857-65578879 TCGTAGGCCCCCAACTCTGAAGG + Intronic
1151384013 17:73744205-73744227 TCTGGGGCCCACAGTCCTCAAGG + Intergenic
1152032604 17:77853547-77853569 TCTAAGACCCCCAGCCCTCCTGG + Intergenic
1152990445 18:358705-358727 CCAGAGGTCCCCAACCCCCAGGG - Intronic
1155797980 18:30064598-30064620 TCTGAGTGCCCCTACCCCCATGG + Intergenic
1158705286 18:59787064-59787086 TCTAAGGCCCACAGGCCTCAGGG - Intergenic
1161108571 19:2456273-2456295 TCAGAAGCCCCCAAACCTCCTGG + Intronic
1161366416 19:3882163-3882185 TCTAAGGCCCCCAACTCTCATGG - Intronic
1161379763 19:3958798-3958820 TCGGTGGGTCCCAACCCTCACGG + Exonic
1162551547 19:11361031-11361053 TCTGAGGCCTCCTGCCCCCAGGG - Intronic
1163004914 19:14391113-14391135 TCTGGTGACCCCAAACCTCATGG - Intronic
1163062755 19:14772285-14772307 TCTGGTGACCCCAAACCTCATGG + Intronic
1163612735 19:18309563-18309585 TCGGAGCCTCCCAACCCTCCCGG - Intronic
1163811340 19:19434260-19434282 TCTGAGGCTTCCCACCCTCGGGG + Intronic
1164431564 19:28193575-28193597 GCTGTGGCCCCATACCCTCAGGG + Intergenic
1164685020 19:30160840-30160862 TCTGAGGCCCCGACACCTCCAGG - Intergenic
1165745807 19:38229085-38229107 TCTGAGGACCCCGGCCCTCGCGG - Intronic
1166690524 19:44819436-44819458 TGTGAAGCCTCCAACCCCCACGG + Exonic
1167152820 19:47719527-47719549 TCTGTGTCCCCCACCCCCCATGG + Intronic
926612005 2:14956318-14956340 TCTGAGCCCTCCAAGTCTCAAGG + Intergenic
927341093 2:21983676-21983698 TCTGAGGCCTCCCAGCCACATGG - Intergenic
932762850 2:74450776-74450798 TCTGAGTCCCCCAACCATGTTGG + Intergenic
933200618 2:79444034-79444056 TCTCAGGCCACCAGCTCTCAAGG + Intronic
934017033 2:87899027-87899049 TCTGAGGCCTCCAAGTCTCTAGG - Intergenic
934164019 2:89278038-89278060 TCTGTGGTCCTCAGCCCTCATGG - Intergenic
934203255 2:89904486-89904508 TCTGTGGTCCTCAGCCCTCATGG + Intergenic
936614312 2:114033042-114033064 CCTGCTGCCCCCAACCCCCATGG + Intergenic
937974860 2:127576528-127576550 TCTGAGGCCCTGAGGCCTCAGGG + Intronic
937975649 2:127580847-127580869 TCTGAGGCCCCCCACCAAAATGG - Intronic
938058287 2:128233211-128233233 TCTGCAGCCTCCAACCCTCCCGG + Intergenic
938219904 2:129557038-129557060 TCTGAGGTGCCCAACCCTCGTGG - Intergenic
939037305 2:137148505-137148527 TCTGAGCCCTCCAAGCCTCTAGG - Intronic
939107427 2:137965048-137965070 ACTGAGGCACTCAATCCTCAGGG - Intronic
939387016 2:141514143-141514165 ACTGACCCCCTCAACCCTCATGG + Intronic
945410059 2:209497243-209497265 TATGAGGCCACCAACCCTACTGG - Intronic
947270459 2:228328326-228328348 TCTCAGGCCGCCAAACCTAATGG + Intergenic
948754631 2:240151676-240151698 TCTGAGGCCCCCTCTCCTCGAGG - Intergenic
1168924160 20:1565974-1565996 TATGGGGCTCCCAACCCCCAGGG - Intronic
1171036358 20:21715289-21715311 TCTGAGCCCACCAGCCCTAATGG + Exonic
1171978044 20:31607747-31607769 CCTGGGGGCACCAACCCTCAAGG + Intergenic
1175375240 20:58519578-58519600 TCTGAGGCCCTGAAACCACATGG + Intergenic
1175798167 20:61785326-61785348 TCAGAGCCGCCCCACCCTCAGGG - Intronic
1175918882 20:62440753-62440775 GGTGAGGAACCCAACCCTCAGGG - Intergenic
1176254364 20:64143253-64143275 TCTCTGGCTCCCAAACCTCACGG + Intergenic
1180054569 21:45351239-45351261 TCTGAGGCCCCCCAGCCTCGTGG - Intergenic
1182221870 22:28765050-28765072 TCTGACAACCCCACCCCTCATGG + Intergenic
1182734209 22:32519665-32519687 TCCAAGGCCCCCAACAATCAAGG + Intronic
1182797705 22:33003345-33003367 TCTGAGCCCTCCAAGCCTCTAGG - Intronic
1183703577 22:39463413-39463435 TCTCAGGGCTCCAAGCCTCAGGG - Intronic
1184187790 22:42876383-42876405 TGTGAGGCCCCCGCCCCGCAAGG + Intronic
1184414938 22:44346787-44346809 TCTGTGGCTCCCAACCCCCATGG + Intergenic
950990782 3:17435148-17435170 TCTGAGCCCCCCAAGTCTCTAGG + Intronic
955120663 3:56054950-56054972 TCAGAGGCTCACAGCCCTCATGG + Intronic
957477212 3:80740152-80740174 TCTGAGCCCCCCAAGTCTCTAGG + Intergenic
961633631 3:128319196-128319218 TCTGTGGCTCCTGACCCTCAAGG + Intronic
962255638 3:133868281-133868303 TCTCAGTCCCCCAACCATAAGGG + Intronic
962326761 3:134440825-134440847 TCTCACACCCCCAACCCACAGGG - Intergenic
965107456 3:164375637-164375659 ACTGAGGCCCCAAACTCTCCTGG - Intergenic
966578731 3:181534951-181534973 ACTGAGGCCTCCAAACCCCACGG - Intergenic
967867469 3:194202119-194202141 CCTCAGGCCAACAACCCTCAAGG + Intergenic
968707035 4:2084014-2084036 TCTCTGGCCACCAGCCCTCAGGG - Intronic
969581319 4:8067216-8067238 TCTGAGGCCCCGGACCTGCAGGG - Intronic
971587173 4:28418666-28418688 TCAGGGGTCCCCAACCCCCAGGG - Intergenic
974485004 4:62493632-62493654 TCTGAGCCCTCCAAGCCTCCAGG - Intergenic
975214911 4:71742224-71742246 AATGAGGCCCCCAATCATCATGG + Intronic
975406775 4:73998999-73999021 TCTGAGGCACGCAGCCCTCTGGG + Intergenic
979038286 4:115753855-115753877 TCTGAGGCCTCCAAGTCTCTAGG - Intergenic
979139295 4:117152037-117152059 TCTGAGGCCTCCAAGTCTCCAGG + Intergenic
980385975 4:132088486-132088508 TCTGAGCCCTCCAAGCCTCTAGG - Intergenic
980671031 4:136008192-136008214 GCAGAAGCCCCCAACCCTCTCGG + Intergenic
980982834 4:139668957-139668979 TCTCAGGGCCCGAACCCCCATGG + Intronic
981693876 4:147539583-147539605 CCTGAGGCCCCCATCCTTCCTGG + Intronic
982394231 4:154898486-154898508 TCTCAGGCCCCCATCTCTCTGGG - Intergenic
985488765 5:166693-166715 GCAGAGGCCTCCAACCCCCAGGG - Intronic
985665707 5:1180674-1180696 TATGAGGCCCCCACCCCACAGGG - Intergenic
985665736 5:1180762-1180784 TGTGAGGCCCCCACCCCACAGGG - Intergenic
986264824 5:6182496-6182518 CCCGAGGCCCCCACCCCTCTGGG + Intergenic
986660790 5:10057979-10058001 TCTGCAGCCCCCACCCATCAGGG - Intergenic
987071006 5:14336963-14336985 TCTGTCTCTCCCAACCCTCATGG - Intronic
988874844 5:35432442-35432464 TCTGAGGAGGCAAACCCTCAGGG - Intergenic
989191783 5:38677377-38677399 TCTCTGGCCCCCAGCCCTCTTGG + Intergenic
989719333 5:44505336-44505358 TCTGAGGGACCCCACCCCCATGG - Intergenic
991665232 5:68993172-68993194 ACTGAGGCCACCAATCCCCAAGG + Intergenic
992811116 5:80389662-80389684 TCCGAGGACCACAACCCTCCGGG + Intergenic
993120186 5:83765408-83765430 TCTGAGGTCTCCTGCCCTCAAGG + Intergenic
998180123 5:139931373-139931395 TCTGAGGGTCCCAATCATCAGGG + Intronic
999030629 5:148287034-148287056 TGTGATTACCCCAACCCTCAAGG + Intergenic
1001837376 5:174843675-174843697 TCGGAGGGCCCCAGCCCTCAGGG - Intergenic
1002410430 5:179070320-179070342 TCAGAGGCCCCCAAGCCTTTTGG - Intronic
1004426087 6:15508029-15508051 GCCGAAGCCCCCAAGCCTCAAGG - Intronic
1007420614 6:41716984-41717006 TTTGATGCCCCCACCCTTCATGG - Intronic
1007632880 6:43282679-43282701 TCTGAGGTCACCCACCCTCCTGG - Intronic
1008459962 6:51757143-51757165 TCAGGGGTCCCCAACCCCCAGGG - Intronic
1008508146 6:52251116-52251138 CCTCAGTCCCCCAACCATCAAGG + Intergenic
1011948408 6:92935328-92935350 TCTGAGGCCTCCAAGTCTCTGGG + Intergenic
1015937120 6:138415329-138415351 TCGGAGGCCCCCATCCCTGGTGG + Exonic
1018527383 6:164728213-164728235 TCTGAGGCCTCCAAGTCTCTAGG - Intergenic
1019095483 6:169576186-169576208 TCTGTGTCCACCCACCCTCAGGG + Intronic
1019321436 7:417196-417218 TCTGAGGCCCGCATCACTCCAGG - Intergenic
1019426906 7:982274-982296 CCTGAGGCCCTCACCCCTCCCGG - Intergenic
1019613194 7:1947220-1947242 TCTGAGGGGCCCTATCCTCAAGG + Intronic
1019739615 7:2666132-2666154 TCTGTGGCTCCCAGCTCTCAGGG + Intergenic
1019864082 7:3688812-3688834 TCTGAGGCACACACCGCTCATGG + Intronic
1019903426 7:4042388-4042410 CCTGAAGCCCCCGACACTCAGGG - Intronic
1024253080 7:47520864-47520886 GGTGAGTCCCCCAACCCTGAGGG - Intronic
1029191844 7:98777495-98777517 TCTGAGACCCCCCAACCCCATGG - Intergenic
1032285971 7:130538667-130538689 TCCCAGGCCCCCAGCCCCCAAGG - Intronic
1032391408 7:131557130-131557152 TGTGGGGCCCCCATCCCGCACGG + Intronic
1034405757 7:150901505-150901527 TCAGAGGCCCCACAACCTCAAGG + Intergenic
1038419993 8:27427844-27427866 TCAGAGGCCCCCAACCTTTTGGG + Intronic
1043353624 8:79389324-79389346 TCAGAAGCCCCCGACCATCACGG - Intergenic
1044381169 8:91535505-91535527 TCTGAGGGCCCAAACCTACATGG - Intergenic
1048668837 8:136694498-136694520 TCTGAGCCCTCCAAACCTCTAGG - Intergenic
1049203395 8:141352377-141352399 TCTGTGCTCCCCACCCCTCACGG - Intergenic
1049578234 8:143399291-143399313 CCTGACACCCCCAACCCTCACGG - Intergenic
1050255791 9:3790633-3790655 TCTGAGCCCTCCAAGCCTCTAGG + Intergenic
1050640282 9:7660310-7660332 TCTGAAGGCACCAAGCCTCAGGG + Intergenic
1050845775 9:10216222-10216244 TCTCAGGCCCCAAACCTTAAGGG - Intronic
1050923113 9:11230542-11230564 TCCAAGCCCCCCAACCATCACGG - Intergenic
1051402017 9:16693326-16693348 TCTGAAGAACCCAACCCTCTGGG + Intronic
1055462907 9:76536235-76536257 ACTGAGTCCCCTAACCCTTAAGG + Intergenic
1055520849 9:77079762-77079784 CCTGTGGCCCCCAACCCAGAGGG - Intergenic
1055606904 9:77979595-77979617 TCTGAGGTCCCAAAGCCCCAGGG + Intronic
1056258497 9:84824559-84824581 TCTGGAGCCCCCAACCCTGTAGG + Intronic
1057034929 9:91805109-91805131 TCTGAGGGGCCTCACCCTCAGGG - Intronic
1059163697 9:112059167-112059189 TCTGATGGCTCCAACCATCATGG + Intronic
1059343123 9:113610728-113610750 TCGGATGCCTCCATCCCTCAGGG - Intergenic
1059803895 9:117777737-117777759 TCTGAAGCCCCCATCACTTAGGG - Intergenic
1060997971 9:127885792-127885814 TCAGAGTCCCCCAACCCTGAAGG + Exonic
1061013789 9:127970687-127970709 TCTGTGGCTCCCACCCCTCCAGG + Intronic
1062524978 9:136974566-136974588 TCAGAGGTACCCAAGCCTCACGG - Intergenic
1062725190 9:138069022-138069044 TCTCAGGCCCCCAACCTGCTGGG - Intronic
1186777286 X:12877805-12877827 TCAGAGGCCCCAAACCCTCCTGG + Intronic
1187563895 X:20429083-20429105 CTTGAGGTCCCCAACCCTTAGGG + Intergenic
1187598320 X:20799391-20799413 TCTGAGGCCTCCAAGTCTCTAGG - Intergenic
1188873227 X:35399238-35399260 TCTGAGCCCTCCAAGCCTCTAGG + Intergenic
1189775266 X:44464810-44464832 TCTGAGCCACCCAACACCCATGG + Intergenic
1190885987 X:54531182-54531204 TCTGAGCCCCTCTACCCCCACGG - Intronic
1192148064 X:68694892-68694914 TCTGAGGCCCCCAACCTCTGGGG - Intronic
1192261314 X:69507134-69507156 TGTGAGGCCACCACCCCTCCTGG - Intronic
1197025545 X:121744585-121744607 TCTGAAGCCCCCAAGAATCAGGG - Intergenic
1198932460 X:141875979-141876001 GAAGAGGGCCCCAACCCTCAGGG + Intronic
1198966807 X:142236441-142236463 TCTGAGCCCTCCAACTCTCTAGG - Intergenic
1199127450 X:144139518-144139540 TCTGAGGCCTCCAAGTCTCTAGG + Intergenic
1200134764 X:153869555-153869577 TGTGAGGCCCGCAACCGGCACGG - Exonic
1200143331 X:153912992-153913014 TCGCAGGGCCCCAGCCCTCAGGG + Intronic
1201950184 Y:19555087-19555109 CATGAGGGCCCCAACCTTCAGGG + Intergenic