ID: 1138659109

View in Genome Browser
Species Human (GRCh38)
Location 16:58507438-58507460
Sequence TTGTAGAAGAATGAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 577}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138659109_1138659112 3 Left 1138659109 16:58507438-58507460 CCCTCCTTCTCATTCTTCTACAA 0: 1
1: 0
2: 2
3: 52
4: 577
Right 1138659112 16:58507464-58507486 TTAAGCACCTGCTGTGTGCATGG 0: 2
1: 11
2: 130
3: 786
4: 2827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138659109 Original CRISPR TTGTAGAAGAATGAGAAGGA GGG (reversed) Intronic
900500858 1:3003844-3003866 TTTGACAATAATGAGAAGGAAGG - Intergenic
900873146 1:5319940-5319962 TTGTAGCAGCATGAAAAGCATGG - Intergenic
902726724 1:18341108-18341130 GAGAAGAAGAAGGAGAAGGAGGG - Intronic
902752201 1:18524561-18524583 TTGTAGTATGATGAGAAGAATGG - Intergenic
902754221 1:18538508-18538530 GTGAAGGAGAAAGAGAAGGAGGG - Intergenic
902795008 1:18795430-18795452 TTAGGGAAGGATGAGAAGGAGGG - Intergenic
903864758 1:26389912-26389934 TAGGAGCAGAATGAGGAGGAAGG + Intergenic
904204418 1:28843983-28844005 TGGTAGAAGAATTAAAAGCAGGG - Intronic
904708029 1:32406530-32406552 TGAGAGAAGAATGAGAAGCAGGG + Intergenic
906730586 1:48077610-48077632 GGGAAGGAGAATGAGAAGGAGGG + Intergenic
906983828 1:50661519-50661541 TGATAAAAGAATGAGATGGATGG - Intronic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907790366 1:57657961-57657983 TTGTTGAAGAAAAGGAAGGATGG - Intronic
907807259 1:57833432-57833454 ATGTACAAGAATGGGAAGCATGG - Intronic
908226246 1:62059046-62059068 TTAGAGAAGAATGAAAAGGCAGG - Intronic
909397624 1:75188027-75188049 ATGTAGAAGGAAGGGAAGGAAGG - Intergenic
909660006 1:78071534-78071556 AAGAAGAAGAAGGAGAAGGAAGG - Intronic
909733641 1:78929174-78929196 TTTTAGAAGAGTAAGGAGGAAGG - Intronic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
910824680 1:91393242-91393264 TTGAGCAAGAATGAGAAGAATGG - Intronic
911067412 1:93802905-93802927 TTGCAGACAAAGGAGAAGGAGGG - Intronic
911096082 1:94056258-94056280 TTTGAGAAGAATCAGAAGGGAGG - Intronic
912139883 1:106711226-106711248 TGGTAGAAGAATGATAATTAAGG + Intergenic
912169507 1:107081498-107081520 ATGAAGAAGAATGGAAAGGAAGG + Intergenic
913522578 1:119659784-119659806 TTGTAGAAGAGAGAGGGGGAGGG - Intronic
914512950 1:148350971-148350993 TTTAAAAAGAAAGAGAAGGAAGG + Intergenic
914964655 1:152244181-152244203 ATGGAGAAGAAGGAGAAGGGAGG - Intergenic
915182469 1:154074379-154074401 TTGAGGAAGGAAGAGAAGGAGGG - Intronic
915607281 1:156960583-156960605 TTGGAGAGTGATGAGAAGGATGG - Intronic
915663958 1:157427889-157427911 ATTAAGAAGAATGAGAAAGAAGG + Intergenic
916144161 1:161725263-161725285 TTGTAGGTGAGTGGGAAGGAAGG - Intronic
916323341 1:163530419-163530441 ATGGAGAAGAAGGGGAAGGAAGG - Intergenic
916526290 1:165612537-165612559 TTTTAGAAATATGAGAGGGATGG + Intergenic
916528630 1:165634833-165634855 ATGATCAAGAATGAGAAGGAAGG - Intronic
916542053 1:165766484-165766506 TTGCAGAAGAATGATCAGTAAGG + Intronic
916555721 1:165892727-165892749 CTGCAGAAGAATGTAAAGGAGGG + Intronic
916750371 1:167718103-167718125 TTGTTGAAGAATGAGTAGGCTGG - Intergenic
917325882 1:173831514-173831536 TTCTTGGAGAGTGAGAAGGAAGG - Exonic
917713246 1:177708845-177708867 TTTTAAATGATTGAGAAGGAAGG + Intergenic
918495177 1:185127253-185127275 TTTTAGAAGAACTAGAAGGTAGG + Intronic
918652740 1:186985873-186985895 TTGTATAATAATGAAAAGAAAGG + Intronic
919059755 1:192617207-192617229 TTGTAAATGAATGGGAAAGAAGG - Intergenic
919214212 1:194531401-194531423 TTCCAGAAGAAAGAGAAAGATGG - Intergenic
919784016 1:201246712-201246734 TTGCTGAAGAAGGAAAAGGAGGG + Intergenic
920559439 1:206928817-206928839 TTTTAGAATAAGGAGGAGGAGGG - Exonic
921020008 1:211226669-211226691 ATCTAGTAGAATGAGAATGAGGG + Intergenic
922339227 1:224642105-224642127 TTGTTCAAGGATGTGAAGGATGG + Intronic
923687634 1:236164330-236164352 ATGTACAAGAATGAAAAAGAGGG - Intronic
924179029 1:241423140-241423162 ATGTAGGAGAATTAGTAGGATGG + Intergenic
924368778 1:243324403-243324425 TGGTATAAGAATGAAAAGGTAGG - Intronic
924437210 1:244052444-244052466 GTGTAGAAGAACAAGAAGAAAGG + Intronic
924495948 1:244589104-244589126 ATGTAGAAGAAAGAGAGGTATGG - Intronic
924911997 1:248523048-248523070 CTGCACAAGGATGAGAAGGATGG - Intergenic
1063425445 10:5946899-5946921 ATGTAGGAGACTGTGAAGGAAGG + Intronic
1063908871 10:10809474-10809496 TTGTTCCAGAATGAGAAAGATGG - Intergenic
1064462767 10:15551029-15551051 TTGGAGAAGAATGGGGTGGATGG + Intronic
1064589666 10:16875889-16875911 TTGTTGAATAAAGAGAAGGATGG - Intronic
1065065437 10:21958940-21958962 TGGTAAAAGGAAGAGAAGGAAGG - Intronic
1065415013 10:25474846-25474868 TTGTGGAAGACTAAGAATGAGGG + Intronic
1066213052 10:33258663-33258685 CTGTAGAAGAATCAGAAGCCAGG - Intronic
1066341774 10:34541481-34541503 TTGTACAAGGTTGAGATGGAAGG - Intronic
1067093773 10:43285314-43285336 TTCTAGAAGAGAGAGGAGGAGGG - Intergenic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1067724663 10:48761017-48761039 AGGTAGAAGAATGAGAATGGAGG + Intronic
1068005060 10:51383307-51383329 GAGTAGAAGAAAGAGAAGGAGGG + Intronic
1068562935 10:58537172-58537194 TTCCACAAGATTGAGAAGGAGGG + Intronic
1069180328 10:65351035-65351057 TTGCAGAAGAACATGAAGGATGG - Intergenic
1069190598 10:65483206-65483228 TTGTAGAAAGAAGTGAAGGAAGG - Intergenic
1069190933 10:65488780-65488802 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
1069210262 10:65749175-65749197 TTGTAGAAGCCAGAGAAAGATGG + Intergenic
1069536982 10:69261112-69261134 TTGGAGAAGAAGGATAAGGTTGG - Intronic
1071895852 10:90065817-90065839 TGGTAGAAGAATGAGAGAAATGG + Intergenic
1071945317 10:90637466-90637488 ATATAGAGGAATGAGAAGGGAGG + Intergenic
1073085739 10:100887493-100887515 TTGAGGAAGAATGAGGAGCAAGG - Intergenic
1073190553 10:101647699-101647721 TTTCAGAAGAATGATAAGAAAGG + Intronic
1073599080 10:104829378-104829400 ATCTGGAAGCATGAGAAGGAAGG + Intronic
1073625518 10:105091784-105091806 TGGGAGAAGAATGAGATGTAGGG + Intronic
1073732042 10:106300513-106300535 TTGCAAAGGAATGAGAATGATGG - Intergenic
1073740981 10:106406569-106406591 GTATAAAAGAAAGAGAAGGATGG + Intergenic
1073965191 10:108980738-108980760 TTGTAAAAAAATGATAATGAAGG + Intergenic
1074871858 10:117583231-117583253 TTGGGGAAGAATCATAAGGAAGG - Intergenic
1074979250 10:118606464-118606486 TTGGAGAAAAATGAGAAGCTAGG + Intergenic
1077308081 11:1876729-1876751 TTGTGGAGGAAGGAGAAGAAGGG + Intronic
1077427261 11:2488407-2488429 TTGGGAAAGATTGAGAAGGATGG + Intronic
1077864671 11:6212152-6212174 TTGATTAAGACTGAGAAGGATGG - Intronic
1078423900 11:11234031-11234053 TTGGAAATGAATGCGAAGGAGGG - Intergenic
1078489288 11:11754478-11754500 TTGTAGAAGGATGACTTGGAAGG - Intergenic
1078619054 11:12891161-12891183 TAGGATAGGAATGAGAAGGAAGG - Intronic
1078850966 11:15163320-15163342 AGGGAAAAGAATGAGAAGGAAGG - Intronic
1078862386 11:15261736-15261758 TTGAAGAATATTGAGAAAGATGG + Intergenic
1079021710 11:16914566-16914588 TTGTAGTTGGATGTGAAGGAAGG - Intronic
1079139403 11:17798017-17798039 GTGTGTAAGAAAGAGAAGGAAGG + Intronic
1079627328 11:22631850-22631872 TTGCAAAAGATTGAGAAAGAGGG - Intronic
1079927409 11:26511670-26511692 GAGTAGAAGAAAGGGAAGGAGGG + Intronic
1080731312 11:34957433-34957455 TAGTAGAAGAAGGAGAAGATTGG + Exonic
1081563862 11:44244092-44244114 TTTGAGCAGAATGAGAAGGATGG - Intronic
1083194388 11:61075340-61075362 TTGTTGATGAATGATAAAGAAGG + Intergenic
1085871139 11:80350598-80350620 TTGTGGAGAAATGAGAAAGATGG + Intergenic
1086302115 11:85438103-85438125 TGAGAGAAGAAAGAGAAGGATGG + Intronic
1087301784 11:96444266-96444288 TGGGAGAAGAAAGAGAAGAATGG - Intronic
1088552725 11:111030337-111030359 TTTCAAAAGATTGAGAAGGAGGG + Intergenic
1088925437 11:114296503-114296525 TTCTGGAGGAAAGAGAAGGAGGG + Exonic
1089787175 11:120916040-120916062 TCCTAGAAGAATGAGGAGGAAGG + Intronic
1090109736 11:123893926-123893948 TGTTAGAAAAATGGGAAGGAGGG + Intergenic
1090875149 11:130782445-130782467 TTGTAAAAAAATGTGAAGTATGG + Intergenic
1090933333 11:131319412-131319434 ATGAAGAGGAAGGAGAAGGAGGG - Intergenic
1091112185 11:132979814-132979836 TTGTAAGAGACTGAGAAGGAAGG + Intronic
1091410833 12:238089-238111 TTCTAGGAGAATGGGAAGGAAGG + Intronic
1092445131 12:8548561-8548583 ATGTAGAAGGATGACAAAGATGG - Intergenic
1092519279 12:9250813-9250835 TTCTAAAAGATTGAAAAGGAGGG + Intergenic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1094421767 12:30278730-30278752 GTGTGGAAAAATGAGAAGGGTGG + Intergenic
1095345373 12:41143300-41143322 CTGTATTGGAATGAGAAGGATGG + Intergenic
1095449554 12:42315768-42315790 TTGTAAAAGAAAGAAAGGGAGGG - Intronic
1095747906 12:45680425-45680447 TTGAAGAACAAAGAGAAGGTTGG + Intergenic
1095828998 12:46562719-46562741 TTCTTGAAGAATGAGATGCAGGG + Intergenic
1095896509 12:47285460-47285482 GTCTAAAATAATGAGAAGGAAGG - Intergenic
1097991098 12:65834638-65834660 TTGTTGAAGGAAGGGAAGGAGGG - Intronic
1098370684 12:69757586-69757608 ATGTAGAAAATTGAGAAGGTAGG + Intronic
1098542461 12:71671970-71671992 TTGTTGTAAAATGAGAAGGCTGG - Intronic
1099816093 12:87649605-87649627 TTACAGAAGAATGAGAAATAAGG + Intergenic
1100353318 12:93805633-93805655 TTGTTGGGGAAGGAGAAGGAGGG - Intronic
1100476981 12:94943980-94944002 GTGTTGAAGAAACAGAAGGAAGG + Intronic
1101061751 12:100979570-100979592 TGGTAGAGGAAGGAGAAAGAGGG + Intronic
1101866215 12:108521908-108521930 TTGTATAAAAAAGAGATGGAGGG + Intronic
1102408760 12:112698807-112698829 AAGTAGGAGAAGGAGAAGGAGGG - Intronic
1102999024 12:117371032-117371054 TTTTGGAAGAATGAGAAGTCTGG + Intronic
1103363246 12:120366455-120366477 TTCTGGGAGAAAGAGAAGGATGG - Intronic
1104433545 12:128737005-128737027 CTGAAGAAGAAAGAAAAGGAAGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106617382 13:31341818-31341840 TTGAAAAAGAATTAGAAGAATGG + Intergenic
1107259019 13:38468536-38468558 TTGTAGAAGATTGAAAAATATGG - Intergenic
1107783071 13:43925943-43925965 TTGTAGCAGAAAGTGGAGGATGG - Intergenic
1107860961 13:44660661-44660683 TTGTGGAGGGATGAGATGGAGGG - Intergenic
1107898286 13:44987904-44987926 TTGTAGAAGATGGGGGAGGAGGG - Intronic
1108087297 13:46806824-46806846 TTTTAGAAGATGGAGTAGGAGGG + Intergenic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1109050362 13:57472984-57473006 TGGTAGAAGAGTGAGAGGGATGG + Intergenic
1109160791 13:58971074-58971096 TACTAGAACATTGAGAAGGAAGG - Intergenic
1109375196 13:61484030-61484052 TTGTAGAAAAGAGAGATGGAAGG + Intergenic
1109610615 13:64760293-64760315 TGGATGAAGAATGAGAAGCAAGG + Intergenic
1109630191 13:65034685-65034707 TTGTATAAGAATGCGAGGTAAGG - Intergenic
1109756314 13:66765139-66765161 TTTTAGAAAAAAGAGAGGGAGGG - Intronic
1109992548 13:70077971-70077993 TTTTAGAAGAATGATAAATATGG - Intronic
1110562655 13:76925944-76925966 TTCTGGAAGAATTAGATGGATGG - Intergenic
1111670918 13:91329133-91329155 TTGTAGAACAAGGAGAAGGTTGG + Intergenic
1112138352 13:96609405-96609427 TTTTACAAGAATGAAAAGAAAGG - Intronic
1113137291 13:107106342-107106364 TTCCAGAAAATTGAGAAGGAGGG - Intergenic
1113359757 13:109619412-109619434 AGGTAGAAGAAAGAGAAGAATGG - Intergenic
1113751288 13:112778051-112778073 CTGTAGAAGAAGGAACAGGAAGG - Intronic
1114198371 14:20499482-20499504 TTTTATATGAATGAGAAGAAAGG + Intergenic
1114834985 14:26193516-26193538 GTGTAGAAAGAAGAGAAGGAAGG + Intergenic
1114904869 14:27114869-27114891 TTTCAAAAGACTGAGAAGGAGGG - Intergenic
1115297513 14:31845841-31845863 TTGGAGAAAAATAAGAAGGGAGG - Intronic
1115371544 14:32620699-32620721 TTCTAAAAGATTGAGAAAGAAGG - Intronic
1116423552 14:44762386-44762408 TACTAGAAGAAAGAGAGGGATGG - Intergenic
1116630012 14:47318748-47318770 CTGTAGTAGAATGAAAAGGAGGG + Intronic
1116898435 14:50339496-50339518 TTGAAGAAGGAAGAGAGGGAGGG + Intronic
1118772659 14:68952518-68952540 GGGTCAAAGAATGAGAAGGAAGG + Intronic
1120049770 14:79851769-79851791 CTGTAGAAGAAACAGAGGGAAGG - Intronic
1120302624 14:82727607-82727629 TTTTAGAAAAATGAGAAGTAAGG + Intergenic
1120634371 14:86932919-86932941 TAGTAGAATCATTAGAAGGAAGG + Intergenic
1122091379 14:99343161-99343183 TTCTAGAAGACAGTGAAGGAAGG + Intergenic
1122699502 14:103578262-103578284 TTGCAGAAGAATGGGAAGAATGG + Intronic
1123406017 15:20019897-20019919 ATGCAGGAGAATGAGAAGCATGG - Intergenic
1123515346 15:21026545-21026567 ATGCAGGAGAATGAGAAGCATGG - Intergenic
1124087776 15:26567890-26567912 TTATAGAAGAATTAGGAGGGGGG + Intronic
1125286092 15:38093946-38093968 GTCTAGAATAATGAGCAGGAGGG + Intergenic
1125944266 15:43700501-43700523 CTGTAGAACAGTGGGAAGGAAGG + Intergenic
1126245005 15:46494459-46494481 TTGTAGAATAATTAGAAGTCGGG - Intergenic
1126504366 15:49387099-49387121 TTCCAAAAGATTGAGAAGGAAGG + Intronic
1126683665 15:51228191-51228213 TTAGAGAAGAAAGAGAAGTAAGG - Intronic
1126886668 15:53158305-53158327 AAGGAGGAGAATGAGAAGGAGGG + Intergenic
1128100909 15:64999110-64999132 TTGTAGGAATATGAGTAGGAAGG - Intergenic
1129695259 15:77737386-77737408 TTGTAAAAGAAAGAGAAGGGAGG + Intronic
1129932603 15:79424876-79424898 GTGGAGAAGAAATAGAAGGAAGG + Intronic
1130605189 15:85309438-85309460 TTCCAAAAGAATGAGAAAGAGGG + Intergenic
1130787896 15:87120506-87120528 TAGTAAAATAATGAGATGGATGG + Intergenic
1131357613 15:91759039-91759061 TACTAAAAAAATGAGAAGGATGG + Intergenic
1131589854 15:93736971-93736993 TTCCAGAAGATTGAGGAGGAGGG - Intergenic
1131636630 15:94239732-94239754 TTGGCAAAGAATGAGAAAGAAGG + Intronic
1131664876 15:94559514-94559536 TTGTATACTGATGAGAAGGATGG - Intergenic
1131737397 15:95348365-95348387 AGGTAGAAGAGTGAGAAGGAGGG - Intergenic
1132326166 15:100972414-100972436 TTGAAGAATAAAGAGAAGGTTGG + Intronic
1132668765 16:1094322-1094344 GTGTTAAAGAATGAGAAGGCTGG + Intronic
1133162559 16:3921679-3921701 TGGTAGAACAATCAAAAGGATGG - Intergenic
1133342650 16:5046724-5046746 ACGTAGAAGAAAGGGAAGGAGGG - Intronic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1134103007 16:11465746-11465768 TTGTAAAAGAAAGAGAAGGCGGG + Intronic
1134541034 16:15065745-15065767 TTGCAAAAGAATTAGAAGGTTGG + Intronic
1134856928 16:17527812-17527834 TTTTATAAGTATGATAAGGAGGG - Intergenic
1135436486 16:22430289-22430311 TTGCAAAAGAATTAGAAGGTTGG + Intronic
1135674568 16:24404466-24404488 TGGTAGAAGAGTCAGCAGGACGG + Intergenic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1136263771 16:29101626-29101648 TTGCAAAAGAATTAGAAGGTTGG - Intergenic
1136481359 16:30543988-30544010 TAGTATAAGAATGAGTAGAAGGG + Intronic
1137227362 16:46526402-46526424 TTTTAAAAGATTGGGAAGGAGGG + Intergenic
1137518951 16:49175244-49175266 TAGTAGAAGAGGGAGAGGGAGGG - Intergenic
1137768333 16:50995003-50995025 ATGTAGGACAATGTGAAGGACGG + Intergenic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1138722154 16:59094879-59094901 TTGCAGAAGAAACACAAGGAGGG + Intergenic
1139656450 16:68389935-68389957 TTAGAGAAGAAACAGAAGGATGG + Intronic
1139730279 16:68938241-68938263 CTGAAGAACAATGAGAAGGTTGG + Intronic
1139807732 16:69583456-69583478 TTTTGGAAGAATGAGATGGGAGG - Intronic
1140302496 16:73772006-73772028 ATGTAGAAGAAAGAAAAGAAAGG - Intergenic
1141978720 16:87535923-87535945 AGGTAGAACAATGAGAAGGCAGG - Intergenic
1142362781 16:89635221-89635243 GTGAGGAAAAATGAGAAGGAAGG - Intronic
1143325323 17:6094761-6094783 TGGCAGAAGCAAGAGAAGGAAGG + Intronic
1143730532 17:8880385-8880407 TGGCAGTAGAAGGAGAAGGATGG - Exonic
1143856541 17:9855270-9855292 TTGCAGAAGAAGGGGAAGAAAGG + Intronic
1144051135 17:11498020-11498042 TTTTGGAAGAAAGAGAAGAAAGG + Intronic
1144334341 17:14255524-14255546 TTGTAGGAGAGGGAGGAGGAGGG - Intergenic
1144461259 17:15460355-15460377 TTGTAGAATAAAGAGAACGAAGG - Intronic
1146298607 17:31671104-31671126 TTGTAGCAGAAAGAGAATGATGG - Intergenic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147512525 17:41083718-41083740 TTGGAAAGGAATTAGAAGGAAGG - Intergenic
1147514690 17:41104900-41104922 TTGGAAAGGAATTAGAAGGAAGG - Intronic
1148527389 17:48353597-48353619 TTAAAGAAGAATGAGATGGCCGG + Intronic
1148617489 17:49012207-49012229 TTGAAGAAAATTGAGATGGATGG + Intronic
1150138534 17:62709581-62709603 TGGTAGATGAAGGAGAGGGAAGG + Intronic
1150144893 17:62760525-62760547 TTATAGAAGAGTGACAAGGAGGG - Intronic
1150573780 17:66411928-66411950 TTGTAATAAAATGAGAAGTATGG + Intronic
1151250605 17:72831010-72831032 TTGTAGAAAAATGAGGAGCCTGG + Intronic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1153488575 18:5626981-5627003 GTGTAGAAGAGAGAGAAGGCAGG + Intronic
1153604535 18:6818557-6818579 TTATTGATGAATGAGAAGCAGGG + Intronic
1154348437 18:13563690-13563712 TTATTGATGTATGAGAAGGACGG - Intronic
1155881094 18:31149847-31149869 TTGGAGAAAAATGAGTAGGAAGG - Intronic
1156086255 18:33407402-33407424 AAGTAGAAGGAAGAGAAGGAAGG + Intronic
1156143988 18:34153000-34153022 TTTAAGAAGAAAGAGAAGCATGG + Intronic
1156713920 18:39983018-39983040 TGGAAGAAGGAAGAGAAGGAGGG + Intergenic
1156777310 18:40807692-40807714 TTGGAGAAGAGAGAGAGGGAGGG - Intergenic
1157369634 18:47098995-47099017 AAGGAGAAGAAAGAGAAGGAAGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157917482 18:51680380-51680402 TTGCAGCAGTATGAGAAGGCTGG - Intergenic
1158186576 18:54778701-54778723 TGGAAGAAGAATGGAAAGGAAGG - Intronic
1158201982 18:54951351-54951373 CTGGAGAAGAGTGGGAAGGAGGG + Intronic
1158420313 18:57287351-57287373 TTGGAGAAGATGGAGTAGGAGGG - Intergenic
1158809867 18:61020127-61020149 TTGGAGAAGAGTGGGATGGATGG - Intergenic
1158979665 18:62747522-62747544 TTGAAGAAGGAAGCGAAGGAAGG - Intronic
1160031443 18:75264506-75264528 GTGTAGGAGAAGGAGAAGAAAGG + Intronic
1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG + Intergenic
1160572110 18:79824992-79825014 TTTCAGAACATTGAGAAGGAAGG - Intergenic
1161550733 19:4910649-4910671 GTGTTGAAGATTGAGGAGGAAGG - Intronic
1161675610 19:5646795-5646817 ACATAGATGAATGAGAAGGAAGG + Intronic
1162131358 19:8527921-8527943 TTATATAAGAAACAGAAGGAGGG + Intronic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1163060477 19:14757427-14757449 TTGAAGAAGAACAAGAAGGTTGG + Intronic
1164010436 19:21198798-21198820 CTTTAGAGGAATTAGAAGGATGG + Intergenic
1165019081 19:32908411-32908433 GGGTAGAGGAATGAGAAGGATGG + Intronic
1165768543 19:38365218-38365240 TTGAGAAAGAATGAGAAGAAAGG - Intronic
1167567339 19:50264910-50264932 TTGGAAAGGAATGAGAAGGATGG + Intronic
1168096677 19:54119790-54119812 TTCAAGAAGAATGGGAAGGCTGG - Intronic
926014764 2:9440675-9440697 TTGTGGAAGAAAGACAAGGATGG + Intronic
926707147 2:15844907-15844929 TTGTAGAGGAATGGAAGGGAGGG - Intergenic
926915413 2:17886708-17886730 TGGTGGAAGAATGGGATGGATGG - Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927280886 2:21305448-21305470 TTGGAGAAGAAAGTGAAGGCAGG + Intergenic
928019472 2:27691074-27691096 TTCCAAAAGAATGAGAAAGAAGG - Intronic
928644869 2:33341289-33341311 TTGGAGAAGGATGAGCAGGTGGG + Intronic
929219719 2:39450499-39450521 TTGTAAAAGAAACAAAAGGAAGG + Intergenic
929237374 2:39620353-39620375 TTTTAAAAGGAAGAGAAGGAAGG - Intergenic
929760975 2:44805946-44805968 TCTTAGAAGAATGAAATGGAAGG - Intergenic
929904336 2:46033059-46033081 ATGTAGAAGCATGAGTTGGATGG + Intronic
930307926 2:49699853-49699875 TTGGAGAAGCCTAAGAAGGATGG - Intergenic
930456154 2:51610080-51610102 TTGTTGAAGAGTGAGAAAGCTGG + Intergenic
930564016 2:52996869-52996891 TAGTAGAAGGAAGAGAAGGAAGG + Intergenic
931545906 2:63387093-63387115 TTCCAAAAAAATGAGAAGGAAGG + Intronic
931601067 2:64003578-64003600 TTATAGATGAATGAAATGGATGG + Intronic
931681787 2:64756007-64756029 AAATAGAAGAATTAGAAGGAAGG + Intergenic
932290176 2:70570568-70570590 TTCTAATAGAATTAGAAGGAGGG - Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
933101756 2:78268684-78268706 AAGTAGAAGAATGAGAGGCATGG + Intergenic
933408351 2:81891903-81891925 ATGTCGTAAAATGAGAAGGAAGG + Intergenic
933912648 2:86956882-86956904 AGGTGGAAGAATAAGAAGGATGG + Intronic
934010346 2:87813008-87813030 AGGTGGAAGAATAAGAAGGATGG - Intronic
935654741 2:105412488-105412510 TTGTAGAAGGATGAGATTCAGGG + Intronic
935773914 2:106453728-106453750 AGGTGGAAGAATAAGAAGGATGG - Intronic
935906149 2:107842185-107842207 AGGTGGAAGAATAAGAAGGATGG + Intronic
936706801 2:115085088-115085110 TTGTAGAAGAATTTGTAGCAAGG + Intronic
937229312 2:120388316-120388338 TTGAAGGATAATGAGGAGGAAGG + Intergenic
937602817 2:123759421-123759443 TTCTAAAGGATTGAGAAGGAGGG + Intergenic
938182919 2:129199900-129199922 TTGTTAAAGAATGGTAAGGAAGG - Intergenic
938507256 2:131899271-131899293 TTTGAAAAAAATGAGAAGGAAGG + Intergenic
939047198 2:137263825-137263847 TAGTAGAACTATGAGTAGGAAGG - Intronic
939142903 2:138376840-138376862 TGGTAGCAGAAGGGGAAGGAGGG - Intergenic
939626318 2:144481955-144481977 TTATAGAAAAATGAGAAATAAGG + Intronic
939654324 2:144804364-144804386 TGTTGGAAGAATTAGAAGGAAGG - Intergenic
939749356 2:146022462-146022484 TGCTAGTAGAATGAGCAGGAGGG + Intergenic
940456090 2:153902596-153902618 TTGTAGAGGGATAAGAATGAAGG + Intronic
940786423 2:157986458-157986480 TAATAGAAGAAGAAGAAGGATGG + Intronic
941293080 2:163700372-163700394 TTGAAGAAGAGAAAGAAGGAAGG + Intronic
941342363 2:164323159-164323181 TTTTAGAAGGCTGAGGAGGAAGG - Intergenic
941509440 2:166387418-166387440 TTGTTCAAGAATTAGATGGATGG + Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942999351 2:182305130-182305152 TTGGAGAAGAGAGACAAGGAAGG - Intronic
943726341 2:191255475-191255497 GTGTTAAAGAATGAGGAGGATGG + Intronic
944348922 2:198703816-198703838 TTGTGGAGGAGTGAGAGGGAAGG + Intergenic
944593891 2:201244381-201244403 CTGTAGGAGAGAGAGAAGGAAGG + Intronic
944924963 2:204455138-204455160 TCTGAGAAGAATGAGAAGGTGGG - Intergenic
945122614 2:206473073-206473095 TTTTACAAGAATGACAAGTAGGG - Intronic
945268717 2:207917116-207917138 TTGAAGTAGAATGAGGAGAATGG + Intronic
945521192 2:210829502-210829524 TTCCAAAAGACTGAGAAGGAAGG - Intergenic
946809880 2:223512451-223512473 TTGTGGAAGAAAGGGAAGGAGGG + Intergenic
947663364 2:231886797-231886819 TAGTAGGAGAAAGAGAGGGAGGG + Intergenic
947785165 2:232811393-232811415 TTGTGAAAGAAAGAGAAGAAAGG + Intronic
1169173305 20:3484725-3484747 TTCCAGAAGGATGCGAAGGATGG - Intronic
1169621609 20:7513310-7513332 TTGTAGAAGAATGATAGTGTTGG + Intergenic
1169690856 20:8330074-8330096 TTGCAGAAGAATCAGGGGGATGG - Intronic
1169740764 20:8891572-8891594 TTTTAGAAGAAAGAGAAGTCTGG - Intronic
1169935564 20:10879847-10879869 ATTTAGAATCATGAGAAGGAAGG - Intergenic
1170296530 20:14832366-14832388 GGGTTGAAGAATGAGAGGGATGG + Intronic
1170341846 20:15337790-15337812 TTGTAGAACATATAGAAGGAAGG + Intronic
1170726372 20:18931040-18931062 TTGAACTAGAAAGAGAAGGATGG + Intergenic
1170902166 20:20474717-20474739 ATGGAGAAGACTGAGAGGGAGGG + Intronic
1171948823 20:31402737-31402759 TGGTAGAAGATTGAGGAGAAAGG + Intergenic
1173063916 20:39691013-39691035 TGGTAGAAGAATATGCAGGAGGG - Intergenic
1173142207 20:40494340-40494362 TTGCAGAGGAATGAAAGGGAGGG - Intergenic
1175062780 20:56258880-56258902 TTGCAGAAGAAGGCAAAGGATGG + Intergenic
1175214799 20:57386367-57386389 GTGCAGAAGAATGAGAAAGTGGG - Intergenic
1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG + Intergenic
1176786373 21:13261055-13261077 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1176927786 21:14771103-14771125 TGGTAGCAGAAGGAGAAGTAAGG + Intergenic
1176986502 21:15443535-15443557 TTGGAGAAGAAAGAAAAGGGTGG + Intergenic
1177984983 21:27963126-27963148 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1178179390 21:30142773-30142795 TTGTGAAAGAATGAAGAGGAAGG + Intergenic
1179863621 21:44204368-44204390 TGGCAGATGAATGAGGAGGAGGG - Intergenic
1182401650 22:30082277-30082299 TTTTTGAAGATTGAGAAAGATGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182918105 22:34054081-34054103 TTGTGAGAGAATGAGAATGAGGG - Intergenic
1183268158 22:36843608-36843630 CAAGAGAAGAATGAGAAGGAGGG + Intergenic
1183609279 22:38887030-38887052 TATTAGAAGACTGAGAATGACGG + Intergenic
1184748390 22:46469955-46469977 TTGTGGAAGAAAGGGAGGGAGGG + Intronic
949604388 3:5637274-5637296 TGGTGGGAGAATTAGAAGGAGGG + Intergenic
950755811 3:15171595-15171617 TGGTACAAGAAGGTGAAGGAAGG - Intergenic
951679937 3:25284063-25284085 ATGCAGCAAAATGAGAAGGAGGG - Intronic
951866868 3:27318213-27318235 TTGTAGGAGGATGAGAAAAAAGG + Intronic
952162128 3:30704518-30704540 CTGTATAAGAAAGAGAAAGATGG - Intergenic
953126498 3:40095871-40095893 TGGTAGGAGAAGGAGAAGGAGGG - Intronic
954172510 3:48816185-48816207 GCCTGGAAGAATGAGAAGGAGGG - Intronic
956198845 3:66684173-66684195 AAGTAGAAGAAGGAGAAGGAGGG - Intergenic
957268461 3:77998861-77998883 TAGTGGAAGAAAGAGATGGATGG - Intergenic
957274435 3:78072938-78072960 ATGTAGATGAATCAGAATGATGG - Intergenic
957364739 3:79208304-79208326 TTTTACAAGAATAAAAAGGATGG - Intronic
957911854 3:86629198-86629220 TTTAAGAAGAAAAAGAAGGAAGG - Intergenic
958983823 3:100757196-100757218 TTGTAGAAGAAAGAAAGGAAAGG + Intronic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
959444458 3:106421383-106421405 GTGAAGGAGAAAGAGAAGGAGGG + Intergenic
959460551 3:106620748-106620770 ATAGAGAAGAAAGAGAAGGAAGG + Intergenic
959836790 3:110927379-110927401 TTCTTGAAGAAAGAAAAGGAAGG + Intergenic
959839299 3:110955868-110955890 TTTCAGAAGATTAAGAAGGATGG - Intergenic
960237479 3:115300497-115300519 GTGGGGAAGAATGAAAAGGAAGG + Intergenic
960484541 3:118235374-118235396 ATTTAGCAGAAAGAGAAGGAGGG - Intergenic
960694511 3:120383041-120383063 TTGTAGAGGAAAGAGCAAGAAGG + Intergenic
960782829 3:121339003-121339025 TTCTAAAAGACTGAGAAAGAAGG + Intronic
962184396 3:133243080-133243102 TGGAAGATGAATGAGATGGAAGG + Intronic
962453598 3:135544020-135544042 TTGAAGAAGAATAACAAAGATGG - Intergenic
962658078 3:137569802-137569824 TGGTAGAAGAGAGAGGAGGAAGG - Intergenic
962720541 3:138170157-138170179 TTGTAGATGAATTATAAGGGGGG + Exonic
962873508 3:139518464-139518486 GTGCAGAAGGGTGAGAAGGAGGG - Exonic
963229838 3:142898488-142898510 TTGTGGAAGAAAGGGAGGGAGGG - Intergenic
964907395 3:161734419-161734441 CTGGAGAAGAGTGAGAGGGAAGG - Intergenic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
965594873 3:170400692-170400714 AGGAAGAAGAAAGAGAAGGAAGG - Intergenic
966238307 3:177727253-177727275 TTGTAGCAGTCTGAGAAAGAGGG - Intergenic
966654727 3:182342909-182342931 TTGTAAAAGAATGGAAAGAAGGG - Intergenic
966666513 3:182477860-182477882 TAGAAAAAGACTGAGAAGGAGGG - Intergenic
967104887 3:186247734-186247756 TTGCAGAAGAATGAGAAACCAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967482101 3:189984744-189984766 TTATAGATTAATGAAAAGGAAGG + Intronic
967483372 3:190000758-190000780 TTTTAGAAGTTAGAGAAGGACGG + Intronic
968095667 3:195928556-195928578 GAGCAGAAGAAGGAGAAGGAAGG - Intergenic
970648015 4:18145460-18145482 TTGTGGAAGAAAGGGAGGGAGGG - Intergenic
970669956 4:18385144-18385166 TTGAAGCAGAATGAGAAAAATGG + Intergenic
971072169 4:23106435-23106457 TAGTAGAATAATGAAAAAGAAGG + Intergenic
971336714 4:25729944-25729966 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
971562952 4:28104795-28104817 TTGGAGATGAATGAGAGAGAAGG - Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
971799205 4:31266652-31266674 TAGTAGAAGAAAGAGGAGGATGG - Intergenic
972361231 4:38327285-38327307 TGGTAGAAGACTAAGAAGAAAGG - Intergenic
972382899 4:38535917-38535939 TGATACAAGGATGAGAAGGAGGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972841083 4:42930831-42930853 AAATAGAAGAATGGGAAGGAAGG - Intronic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
976147407 4:82055599-82055621 TTGAAGAAGTAAGACAAGGAAGG + Intergenic
976325735 4:83769711-83769733 TTATAGCAGAATGAGAATGAGGG - Intergenic
976525101 4:86078050-86078072 TTGTAGATCAATGAGTAGGGAGG - Intronic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976951667 4:90840243-90840265 GTGGAGAAGAATGAGGAGAAAGG + Intronic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
977827413 4:101550206-101550228 TTGTAGCAGAATTAAAAGGTGGG + Intronic
978021244 4:103815511-103815533 ATGAAGAAAAAGGAGAAGGAAGG - Intergenic
978168244 4:105634691-105634713 TTGTAATAGAAAGAGAATGAAGG + Intronic
978303648 4:107297839-107297861 TTGTAGAAGAAGAACAAAGATGG + Intergenic
978850669 4:113332110-113332132 TTGCAGAAGAAGGAGAAGAATGG - Intronic
979780787 4:124649360-124649382 TTGTAAAAGAATGTGGAGGCAGG + Intergenic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
980461368 4:133119027-133119049 TTCTATAAGAATGAGAAACAGGG - Intergenic
980555790 4:134402421-134402443 TTGTAAAAAATTGAGGAGGAGGG - Intergenic
980877577 4:138677301-138677323 TTGAAGAGCAATGAGAAGGTGGG - Intergenic
981375296 4:144008247-144008269 ATGTAGCAGAAAGAGAATGAGGG + Intronic
981385916 4:144130446-144130468 ATGTAGCAGAAAGAGAATGAGGG + Intronic
981399703 4:144299628-144299650 TTTTAGAAAAGTGAGAAGCATGG - Intergenic
981837616 4:149073546-149073568 AGGGAGAAGAATGAGAAAGACGG - Intergenic
981959459 4:150518615-150518637 TTTAAGGACAATGAGAAGGAAGG - Intronic
982448608 4:155524673-155524695 ATATAGGAGAAAGAGAAGGAAGG - Intergenic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
983056909 4:163108257-163108279 TTGTGGAAGAATGAGAGACAAGG + Intergenic
983139338 4:164129202-164129224 TTGTAGAATAATGATTAAGAAGG + Intronic
983408539 4:167365576-167365598 TTGAAGAAGAGTGAAAAAGACGG + Intergenic
983665815 4:170181056-170181078 TTGAAGAAGAAAGAAATGGAAGG + Intergenic
984252075 4:177347259-177347281 TTGTTGAAGGAAGAGAAAGAAGG + Intronic
985323073 4:188735530-188735552 CTGAAGAAGAAAGAAAAGGAAGG - Intergenic
986227663 5:5831373-5831395 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986624091 5:9707217-9707239 TGGGAGAAGAATGAGAAGGCAGG + Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987649990 5:20728651-20728673 TTGTGGAAGATTGTGAAGAAAGG + Intergenic
987713335 5:21533072-21533094 TTTTAGAAGAAGTAGAATGAGGG - Intergenic
988167207 5:27609163-27609185 ATGAAGAAGAATGAAAGGGAAGG + Intergenic
988222818 5:28370999-28371021 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
988745567 5:34132851-34132873 TTGTGGAAGATTGTGAAGAAAGG - Intergenic
989365889 5:40654648-40654670 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
990186835 5:53218978-53219000 TCGTAGAATAATCATAAGGAGGG + Intergenic
991382228 5:66041598-66041620 TTTGACAAGAATGAGAAGCATGG + Intronic
991609049 5:68431867-68431889 TTGGAGAACTCTGAGAAGGAGGG + Intergenic
991681037 5:69139666-69139688 CTGAAGTAGAATGACAAGGACGG - Intergenic
992315546 5:75550087-75550109 TTCTAGAAAATAGAGAAGGATGG + Intronic
992424296 5:76640367-76640389 ATCTAGAAGAATGAGAAAAAAGG - Intronic
992729120 5:79640314-79640336 TGTTAGAAGAATGGGATGGAGGG + Intronic
992825746 5:80548267-80548289 TTGTAGTTGAATGAGTAGTATGG + Intergenic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
993543931 5:89187536-89187558 ATGAAGAAGAATGAGATAGAGGG - Intergenic
993681665 5:90885856-90885878 ATGAAGAAGAAAGGGAAGGAGGG + Intronic
994252994 5:97558875-97558897 TTGGAGAAGGAAGAGAAGGCTGG + Intergenic
994721753 5:103388515-103388537 TTTTAGCAGATTGAGAAGAAAGG - Intergenic
995070001 5:107909483-107909505 TTGAACAACAATGAGAATGATGG + Intronic
995607060 5:113868360-113868382 TTTTAGAAGTTAGAGAAGGAGGG - Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
996550643 5:124726441-124726463 TTGTGAAAGAATGAGAATTAAGG - Intronic
996624149 5:125549660-125549682 ATGTAGAAGAGGTAGAAGGAGGG - Intergenic
997475067 5:134138039-134138061 GTGCTGAAAAATGAGAAGGAGGG - Exonic
998627825 5:143865473-143865495 TGGCAGAAAAATGAGGAGGAAGG + Intergenic
998642611 5:144028553-144028575 TGGGTGAAGAAAGAGAAGGAGGG - Intergenic
999185623 5:149706235-149706257 TAGTAAAAGTATGGGAAGGAGGG - Intergenic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999367512 5:151032815-151032837 TGGAAGAAGAATGATAAGAAGGG + Intronic
999500158 5:152138908-152138930 TGCTAGAAGAAAGGGAAGGATGG + Intergenic
1000122840 5:158213980-158214002 CTGTAGAAGAAAGAGACAGACGG - Intergenic
1002221406 5:177685612-177685634 TGGCAAAGGAATGAGAAGGAAGG - Intergenic
1002829172 6:803455-803477 AAGTAGAAGAAAAAGAAGGACGG - Intergenic
1003317491 6:5025593-5025615 TTGTGGAAGATAGAGAAGGTGGG + Intergenic
1003561663 6:7185619-7185641 TTGAAGAGGAGTGAGAGGGAAGG + Intronic
1003639587 6:7865412-7865434 TTTGAAGAGAATGAGAAGGAGGG - Intronic
1003673062 6:8177819-8177841 GTCCAGAAAAATGAGAAGGAAGG - Intergenic
1004545019 6:16589175-16589197 TTGTAGAAAAATGAGAGAAAAGG - Intronic
1004869895 6:19894289-19894311 TTGTAGACACATCAGAAGGAAGG + Intergenic
1004986054 6:21084082-21084104 TTGTAGAAGAAAGAAACGGGAGG + Intronic
1005353228 6:24957571-24957593 TTCCTAAAGAATGAGAAGGAGGG + Intronic
1005783960 6:29222972-29222994 GTGTAGAAGAAGGAGAATGAAGG - Intergenic
1007257396 6:40538512-40538534 TTGCAGAACAAAGAGAAAGAGGG - Intronic
1007724132 6:43904275-43904297 CTGTAGAAGAACAAGAAAGAAGG - Intergenic
1008103801 6:47421445-47421467 TTTTAGAATAATGAGAAATAAGG - Intergenic
1008173544 6:48237993-48238015 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
1008185412 6:48383901-48383923 TTACAAAAGATTGAGAAGGAAGG - Intergenic
1008777021 6:55052173-55052195 TTGTAGAAGGACAAAAAGGAGGG - Intergenic
1008852533 6:56040759-56040781 TTATAGCAGAAAGAAAAGGAAGG + Intergenic
1009014513 6:57882750-57882772 TTGTGGAAGATTGTGAAGAAAGG - Intergenic
1009550368 6:65084878-65084900 TTGTGGAGGAATAAGAAAGAGGG + Intronic
1009710392 6:67309866-67309888 TTGTAGAAGAATTTGAAGTCAGG + Intergenic
1009909656 6:69910146-69910168 TAGTACAAGAATTAGAAGTAAGG - Intronic
1010037516 6:71343545-71343567 TTGTAGATTAATGAGATGAAAGG + Intergenic
1010056240 6:71568655-71568677 ATGAGGAAGAATGGGAAGGAGGG + Intergenic
1010950257 6:82028274-82028296 TTTTAGAAGGTTGAGTAGGATGG - Intergenic
1011089235 6:83577037-83577059 TTATGGAAAAATGAAAAGGAAGG + Intronic
1011113783 6:83867335-83867357 TTGGAGAATTATAAGAAGGAAGG + Intronic
1012247070 6:96937929-96937951 TTGGGGAAGAATTAGAAGGCAGG - Intronic
1012530887 6:100234946-100234968 TAGGAGAAGAAAGAGAGGGAAGG + Intergenic
1012719173 6:102719641-102719663 TAGTAAAAGAAGGAGAAAGAGGG - Intergenic
1013648695 6:112171485-112171507 TTGTAGAGGAATGGAAAAGAAGG + Intronic
1014890118 6:126833841-126833863 GAGCAGGAGAATGAGAAGGAAGG + Intergenic
1015057963 6:128927182-128927204 TTCTAGAGGAATGAGAAGAGAGG - Intronic
1015116011 6:129650281-129650303 TTGTAGAAAAAAGGGAGGGAAGG + Intronic
1015139794 6:129917071-129917093 TTGCTGAGGAAGGAGAAGGATGG + Intergenic
1015566613 6:134579201-134579223 TTGTAGAAGAGGGGGAAAGAGGG + Intergenic
1016017404 6:139200179-139200201 GTGTAGAAGAGAGGGAAGGAAGG - Intergenic
1016112933 6:140248429-140248451 TTGTAGAAAAATGCAGAGGAAGG + Intergenic
1017876196 6:158526218-158526240 GTGAAGAAGAATGTGAAGGCTGG + Intergenic
1018873572 6:167801473-167801495 TGGTAGAGGAAGGAGAGGGAAGG - Intergenic
1019091846 6:169543046-169543068 TGTAAGAAGAATGAGAAGGAAGG + Intronic
1020787691 7:12591147-12591169 CAGTGGAAGAATGAGTAGGAAGG + Intronic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1020927127 7:14343662-14343684 TTTTAGAAAAATTAGAAGTATGG - Intronic
1021626824 7:22601878-22601900 TTGTCGAACAATGTGAAGTAAGG + Intronic
1021769919 7:23988885-23988907 TTCTAAAAGATTGAGAAAGAGGG + Intergenic
1021819631 7:24483678-24483700 TTCTAGAAGCATGAGATGGGAGG - Intergenic
1021914452 7:25417697-25417719 TTGTTGAAGAATGACAAGTCAGG + Intergenic
1022376264 7:29814285-29814307 TTGTAGAAGGCAGAAAAGGAAGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022864386 7:34401903-34401925 GTGTAGAAGAATGAAAAGCATGG - Intergenic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1023224605 7:37956105-37956127 GTGAAGAAGAAGGAGCAGGAAGG + Intronic
1024530479 7:50388003-50388025 TTGTTGAAGGATGAGAGGAAAGG + Intronic
1024777713 7:52807003-52807025 GTGTAGAAGGATGAAAAGGGTGG + Intergenic
1024960259 7:54967321-54967343 TTATAGAAGAATGAGCATAAAGG - Intergenic
1025710898 7:63908162-63908184 TTGTTTAAAATTGAGAAGGAAGG - Intergenic
1027384798 7:77648949-77648971 AAGGAGAAGAAAGAGAAGGAGGG + Intergenic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1027493782 7:78862195-78862217 TTGTAAAAGAGAGAGAAGCAAGG - Intronic
1028209432 7:88055200-88055222 TTGGAAAAGACTGAGAGGGAAGG + Intronic
1028295377 7:89123197-89123219 TTGTAGAAGGAAGGGAAGAAGGG + Intronic
1028437454 7:90821113-90821135 ATGTAGAGGAATGTGAAAGAAGG - Intronic
1028478615 7:91279444-91279466 TTTTAGAAGAATATAAAGGATGG - Intergenic
1028843317 7:95452145-95452167 TTGGAGCAGAATGGGAATGAGGG - Intergenic
1029648170 7:101871422-101871444 TGGTAGAAGAGTGAGCAGAATGG + Intronic
1030166182 7:106558008-106558030 TAGTAGATCAATGAGAAAGAAGG - Intergenic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030255339 7:107504532-107504554 TTGCAAAAGATTGAGAAAGAGGG - Intronic
1030503862 7:110395161-110395183 ATATGGAAGAAAGAGAAGGAGGG + Intergenic
1030620034 7:111779137-111779159 ATGTAAAAGAATGGGAAAGAGGG + Intronic
1031181764 7:118427849-118427871 TTCTAGAAGACAGAAAAGGAAGG - Intergenic
1032444229 7:131967699-131967721 TTGTAGAAATTTGAGAAAGAAGG - Intergenic
1033155996 7:138957449-138957471 AAGAAGAAGAAGGAGAAGGAGGG - Intronic
1034711748 7:153198758-153198780 ATGTGGAAGACTGAGGAGGAAGG - Intergenic
1036773628 8:11595206-11595228 TCGTAACATAATGAGAAGGAAGG - Intergenic
1036962299 8:13258219-13258241 CTAAAGAAGAATGTGAAGGAGGG - Intronic
1037318649 8:17623230-17623252 TTGTAGGACAAGGTGAAGGATGG + Intronic
1037657233 8:20895343-20895365 TTGTGGAAATATGAGATGGATGG + Intergenic
1038009408 8:23462902-23462924 AAGAAGAAGAAAGAGAAGGACGG - Intergenic
1038124939 8:24663239-24663261 AAGTAGAAGACTGAGAAGGAAGG + Intergenic
1038428880 8:27484059-27484081 TTGCAGGAGGATGAGAAGGGGGG + Intergenic
1039391142 8:37181593-37181615 TTCTAGAAGAGAGGGAAGGAAGG - Intergenic
1039747674 8:40444425-40444447 TTGAACAACAATGAGAAAGAAGG - Intergenic
1040708700 8:50161960-50161982 TTTTAGAAGAATGAAAGAGAGGG + Intronic
1040740819 8:50572167-50572189 CTATAGGAGTATGAGAAGGAGGG - Intronic
1041609904 8:59833479-59833501 ATGTAGAAGAAGGAGTAGGGAGG + Intergenic
1041715844 8:60931201-60931223 TTCTAAAAAATTGAGAAGGAGGG + Intergenic
1042183134 8:66111927-66111949 TTGTAAAATAAGGAGAAGGTAGG + Intergenic
1042857455 8:73282332-73282354 TAGTAGAAGAGTTAAAAGGAGGG + Intergenic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043497118 8:80813979-80814001 TTCTATAAAAATGGGAAGGAAGG - Intronic
1043636506 8:82390784-82390806 TTGTGGAAGAAGAAGAAGGCTGG + Intergenic
1043661977 8:82755094-82755116 ATGTAGGAGCATGTGAAGGAAGG + Intergenic
1043741814 8:83823931-83823953 TTGTCAATGAATGAAAAGGAAGG - Intergenic
1043938293 8:86168005-86168027 AGGAAGAGGAATGAGAAGGAAGG + Intergenic
1044196389 8:89381430-89381452 TTTTAAAAAAATGAGAAGGAAGG - Intergenic
1044867374 8:96585517-96585539 TTGAAGAGAAATGAGAAGGATGG + Intronic
1045019578 8:98030315-98030337 TGGTAGAAAAATAAAAAGGAAGG + Intronic
1045524953 8:102933598-102933620 TTGGAGAAGAATCACCAGGATGG - Intronic
1045554928 8:103206755-103206777 TGGGAGAAGAGTGTGAAGGAGGG + Intronic
1045709386 8:104965189-104965211 CTGCAGAAGAAGGAGAAGGTGGG + Intronic
1046096836 8:109572664-109572686 CTGGAGCAGAGTGAGAAGGAAGG - Intergenic
1046141317 8:110096676-110096698 AAGAAGAAGAATCAGAAGGAGGG + Intergenic
1046186616 8:110729759-110729781 AGGTAGAAGGAGGAGAAGGAGGG + Intergenic
1046558441 8:115806744-115806766 AAGAAGAAGAAAGAGAAGGAAGG + Intronic
1046558452 8:115806845-115806867 AGGAAGAAGAATAAGAAGGAAGG + Intronic
1046905349 8:119566392-119566414 TTGAAGCAGTATGAGAAGCATGG - Intronic
1047336918 8:123944886-123944908 ATGTAAAACAAGGAGAAGGATGG - Intronic
1047702164 8:127460043-127460065 TTGGAGGACAATGAAAAGGATGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1049058447 8:140257389-140257411 TTGGAGGAGAAGTAGAAGGAAGG - Intronic
1049441742 8:142612776-142612798 TTGTAGCAGAATGAGGAAGCTGG + Exonic
1049566898 8:143344985-143345007 GGGTAGAAAAATCAGAAGGAAGG + Intronic
1049896654 9:116000-116022 TTCTAAAAGAATGAATAGGAGGG - Intergenic
1050723080 9:8613299-8613321 TTCTAGAAGAGAGAGCAGGAAGG + Intronic
1050753633 9:8972482-8972504 GTGTAGAAGAAAAAGAAGAAAGG + Intronic
1051502551 9:17793689-17793711 ATAGAGAAGAATGAGAAGGAAGG - Intronic
1051914215 9:22188535-22188557 TTCTAGAAAATTGAAAAGGAGGG + Intergenic
1052082248 9:24221466-24221488 ATATAGAAGCATGAGAATGAGGG - Intergenic
1052321021 9:27167654-27167676 TTGAAGAATAAAGACAAGGATGG - Intronic
1052629980 9:31025349-31025371 TTGAAGAAGAATGAGGTTGAGGG + Intergenic
1053279045 9:36805622-36805644 CTGTAGAAGGATGGGAAGCAGGG + Intergenic
1053292354 9:36889629-36889651 GTCTAGAAGCAGGAGAAGGATGG - Intronic
1057297449 9:93857622-93857644 TTGTGGAAGCCTGAGAAGGCAGG - Intergenic
1058394816 9:104539252-104539274 TTTAAGAAGAGAGAGAAGGAGGG + Intergenic
1058788518 9:108416809-108416831 GTGATGAAGAAGGAGAAGGAAGG - Intergenic
1058977071 9:110135012-110135034 TGGTAGAAAAATAAGATGGATGG + Intronic
1059661392 9:116405430-116405452 TTGTGGAAGTATGAGTAGGTAGG + Intergenic
1060034300 9:120242033-120242055 GTCTTGAAGGATGAGAAGGAGGG + Intergenic
1060314035 9:122491774-122491796 TGGTGGAAGAGTGGGAAGGAAGG + Intergenic
1060394135 9:123303776-123303798 TTGGGGAAGAATAAGAAGGTTGG - Intergenic
1060489501 9:124072112-124072134 GGGTAGATGAATAAGAAGGATGG + Intergenic
1060623595 9:125090469-125090491 ATGATGAAGAAGGAGAAGGAAGG + Intronic
1061234799 9:129336151-129336173 TGGTAGAACAATGTGTAGGAGGG - Intergenic
1185959317 X:4530292-4530314 CTGCAGAAGAATGAGAAGTTTGG - Intergenic
1186582957 X:10840627-10840649 ATGTTGGAGAAAGAGAAGGAAGG - Intergenic
1186935442 X:14445682-14445704 TTGTGGAAGAATAAGAACTAGGG - Intergenic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1187620600 X:21049160-21049182 TTCTAAAAAAATGAGGAGGAGGG + Intergenic
1188043052 X:25392820-25392842 TTGCTGAAGAAAGAAAAGGATGG + Intergenic
1188230409 X:27656080-27656102 TTGTGGAAGAATATGTAGGAGGG + Intronic
1188274463 X:28182684-28182706 TTGTAGAATAATGGTAATGATGG + Intergenic
1188919132 X:35950065-35950087 TCTTAGAAGAGTGAGAAGGTGGG + Intronic
1189306358 X:39989718-39989740 AAGGAGAAGAATGAGAGGGAAGG - Intergenic
1189538688 X:41963775-41963797 TGGGAGAAGAATGAGAGGCAGGG + Intergenic
1189834007 X:45002868-45002890 TTGGAGAAGAATGAAAAGGGGGG - Intronic
1189865593 X:45323811-45323833 TTGTAGAAGAGTGGGAAGGGTGG - Intergenic
1189866806 X:45338888-45338910 TTCCAAAAGACTGAGAAGGAGGG + Intergenic
1191079788 X:56497319-56497341 TTGTAGAAGAATCATAATGCAGG - Intergenic
1191110045 X:56797150-56797172 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
1191912896 X:66170507-66170529 GTGTAGAAGAAAGAGAACAAAGG - Intronic
1191919229 X:66236648-66236670 TTGCAAAAAAATGAGAAGGAGGG - Intronic
1191969580 X:66798638-66798660 ATGAAGAAAAATGAGAATGAAGG - Intergenic
1192192476 X:68999888-68999910 TTGGGGAAGAATCAGCAGGAGGG - Intergenic
1192709048 X:73560943-73560965 GCCTTGAAGAATGAGAAGGAAGG - Intergenic
1192892240 X:75402836-75402858 TTCCAGAAAAATGAGGAGGAAGG + Intronic
1193168922 X:78314185-78314207 ATGTGGAAGAATTAGGAGGAAGG + Intronic
1193353190 X:80485334-80485356 TTTGAAAAGAATGAGAAGGTAGG - Intergenic
1194217204 X:91145616-91145638 TTTCAGAAAATTGAGAAGGAGGG - Intergenic
1194322657 X:92470977-92470999 TTCTAGAAAATAGAGAAGGAGGG - Intronic
1195252893 X:103065242-103065264 TTGGGGAAGAAATAGAAGGAAGG - Intergenic
1195726298 X:107920542-107920564 TTGCATGAGAATGAAAAGGAAGG - Intronic
1195875644 X:109537392-109537414 CCGTACATGAATGAGAAGGAAGG + Intronic
1195934469 X:110111758-110111780 TTGTAGAAGCATGAGAATGAAGG + Intronic
1196414632 X:115457845-115457867 TTCTGGATGAATGAGATGGAAGG + Intergenic
1196434394 X:115661749-115661771 TTATAAAAGAAAGAGAAGGACGG + Intergenic
1196987902 X:121294985-121295007 GTGTAGAAGCATGAGAATTAAGG + Intergenic
1197031763 X:121824656-121824678 TCTCAAAAGAATGAGAAGGAGGG + Intergenic
1197173372 X:123458780-123458802 GTGTAGGAGAATGGGCAGGATGG - Intronic
1198514022 X:137386143-137386165 TACAAGAAGAATGACAAGGAGGG + Intergenic
1199113997 X:143968547-143968569 TTGAAGAAGAGAGAAAAGGAAGG + Intergenic
1199297043 X:146171140-146171162 TTGCAGATGAAGGAGAGGGATGG - Intergenic
1199891660 X:152089204-152089226 TTGTAGAAGAATTATAAGGAAGG - Intergenic
1200553721 Y:4609407-4609429 TTTCAGAAAATTGAGAAGGAGGG - Intergenic
1200630808 Y:5584457-5584479 TTCTAGAAAATAGAGAAGGAGGG - Intronic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic
1202071452 Y:20996031-20996053 TTTTAGAGGAATTAGAAAGAAGG - Intergenic