ID: 1138659970

View in Genome Browser
Species Human (GRCh38)
Location 16:58511138-58511160
Sequence CACTGGCATCCTCTTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 495}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138659961_1138659970 17 Left 1138659961 16:58511098-58511120 CCGCTCCGCGTCCTCCTTTACAG 0: 1
1: 0
2: 1
3: 6
4: 127
Right 1138659970 16:58511138-58511160 CACTGGCATCCTCTTGAGGGAGG 0: 1
1: 0
2: 6
3: 72
4: 495
1138659962_1138659970 12 Left 1138659962 16:58511103-58511125 CCGCGTCCTCCTTTACAGAAACA 0: 1
1: 0
2: 1
3: 13
4: 209
Right 1138659970 16:58511138-58511160 CACTGGCATCCTCTTGAGGGAGG 0: 1
1: 0
2: 6
3: 72
4: 495
1138659960_1138659970 20 Left 1138659960 16:58511095-58511117 CCACCGCTCCGCGTCCTCCTTTA 0: 1
1: 0
2: 1
3: 6
4: 119
Right 1138659970 16:58511138-58511160 CACTGGCATCCTCTTGAGGGAGG 0: 1
1: 0
2: 6
3: 72
4: 495
1138659963_1138659970 6 Left 1138659963 16:58511109-58511131 CCTCCTTTACAGAAACAGTCCTA 0: 1
1: 0
2: 1
3: 9
4: 161
Right 1138659970 16:58511138-58511160 CACTGGCATCCTCTTGAGGGAGG 0: 1
1: 0
2: 6
3: 72
4: 495
1138659964_1138659970 3 Left 1138659964 16:58511112-58511134 CCTTTACAGAAACAGTCCTACTT 0: 1
1: 0
2: 2
3: 9
4: 159
Right 1138659970 16:58511138-58511160 CACTGGCATCCTCTTGAGGGAGG 0: 1
1: 0
2: 6
3: 72
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138659970 Original CRISPR CACTGGCATCCTCTTGAGGG AGG Intronic
900011206 1:110770-110792 CACTGGGGTCTACTTGAGGGTGG + Intergenic
900027310 1:287334-287356 CACTGGGGTCTACTTGAGGGTGG + Intergenic
900041268 1:466778-466800 CACTGGGGTCTACTTGAGGGTGG + Intergenic
900062699 1:701754-701776 CACTGGGGTCTACTTGAGGGTGG + Intergenic
900229723 1:1550599-1550621 CCCTGGCAGGCACTTGAGGGGGG - Intronic
900428658 1:2592004-2592026 CTCTGCCATCCACTTGAGGTAGG + Exonic
902466427 1:16621350-16621372 CACTGGCATGCTCTCCAGAGTGG - Intergenic
902680538 1:18041071-18041093 CACTGGAATACACTTGAAGGAGG + Intergenic
903988502 1:27247484-27247506 CACTGGAACCTACTTGAGGGTGG - Intronic
904410225 1:30320589-30320611 CACTGGTCCCCTCTGGAGGGAGG + Intergenic
904640871 1:31927337-31927359 CACTGGGGACCACTTGAGGGTGG + Intronic
905276073 1:36819096-36819118 CTCTTACATCCTCTGGAGGGAGG - Intronic
905340231 1:37272982-37273004 CACTGGCCTCTTCTGGAGGATGG + Intergenic
906887915 1:49672325-49672347 CACTGGGGTCTACTTGAGGGGGG + Intronic
907158030 1:52352360-52352382 CTGTGGCTTCCTCTTGAGAGAGG - Exonic
907741578 1:57171219-57171241 CACTGGCATCTTCTTGAATTTGG - Intronic
908083063 1:60601016-60601038 CACTGGGGTCTACTTGAGGGTGG + Intergenic
908858537 1:68456185-68456207 CTCTGACATCCACTAGAGGGGGG - Intergenic
908998787 1:70192796-70192818 CACTGGGGTCCTCTTGAGGGTGG + Intronic
909028685 1:70513204-70513226 GAGTGGCATCCTCTGGATGGGGG + Intergenic
909399601 1:75212349-75212371 CACTGGGACCTACTTGAGGGTGG - Intronic
909682334 1:78306166-78306188 CAGTAGTATCCTCTTGAAGGTGG + Intronic
910889898 1:92007394-92007416 CACTGGGGTCTACTTGAGGGTGG - Intronic
912560852 1:110550556-110550578 TACTGGCAGCCTCTGGAGGCTGG - Intergenic
912732621 1:112122604-112122626 CACTGGGGTCTGCTTGAGGGTGG + Intergenic
914693746 1:150055868-150055890 CACTGGGGCCCACTTGAGGGTGG + Intergenic
916448853 1:164899907-164899929 CACTGGGACCTCCTTGAGGGTGG + Intergenic
916568241 1:166001591-166001613 CACTGGGGTCTACTTGAGGGTGG - Intergenic
916621897 1:166507333-166507355 CACTGGGCTCTACTTGAGGGTGG - Intergenic
917149233 1:171927404-171927426 CACTGGGGTCTACTTGAGGGTGG - Intronic
917253564 1:173089343-173089365 CACTGGGGTCTACTTGAGGGAGG - Intergenic
917703499 1:177605294-177605316 CGCTGGCATCTACTTGAGGGTGG + Intergenic
917990164 1:180367547-180367569 CACTGGGGTCTGCTTGAGGGTGG - Intronic
917998423 1:180465989-180466011 CACTGGAGTCTACTTGAGGGGGG + Intronic
919617513 1:199825952-199825974 CACTGGGAACTACTTGAGGGTGG + Intergenic
919965085 1:202515127-202515149 CACTGGGGTCTACTTGAGGGAGG + Intronic
920763025 1:208804126-208804148 CACTGGGGTCTACTTGAGGGCGG - Intergenic
920795451 1:209132384-209132406 CACTGGCCCCTTCTTGAGAGAGG + Intergenic
921336198 1:214089005-214089027 CACTGGGATCTGCTTGAGGGTGG - Intergenic
921793287 1:219313984-219314006 CACTGGGGCCCACTTGAGGGTGG - Intergenic
921964666 1:221075731-221075753 CACTGGGGCCCACTTGAGGGTGG - Intergenic
922088219 1:222370930-222370952 CACTGGCATCTCCTTGAGTGTGG - Intergenic
922259648 1:223926772-223926794 CACTGGGGTCTACTTGAGGGTGG + Intergenic
923096580 1:230779788-230779810 CCCTGGCATCTACTTGATGGTGG - Intronic
923099192 1:230798746-230798768 CACTGGGATCCTCTGGGGAGAGG - Intronic
923189552 1:231607250-231607272 CACTGGTGTCTACTTGAGGGTGG - Intronic
923915540 1:238499675-238499697 CACTGGGATCTACTTGAGGGTGG + Intergenic
924128961 1:240885731-240885753 CACTGGGATCTACTTGAGAGTGG + Intronic
924340811 1:243029328-243029350 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1063672644 10:8111854-8111876 CACTGACCTCCTCTTCAGGTTGG + Intergenic
1063837705 10:10034739-10034761 CACTTACATCCTTTTGGGGGAGG + Intergenic
1064498920 10:15947313-15947335 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1064503983 10:16009614-16009636 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1064818941 10:19301697-19301719 CACCGGGACCTTCTTGAGGGTGG + Intronic
1066161349 10:32734423-32734445 CACTGGGGTCTACTTGAGGGTGG + Intronic
1066299473 10:34084216-34084238 CACTGGGATCCACTGGAGGCAGG + Intergenic
1066735660 10:38476079-38476101 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1067162652 10:43840383-43840405 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1067260499 10:44685759-44685781 CACTGGAATCATGTTGAGAGAGG - Intergenic
1067768998 10:49110119-49110141 CACTGGGAAGCTCTTGAGGGCGG - Intronic
1068402490 10:56548519-56548541 CACTGGGGCCCACTTGAGGGTGG - Intergenic
1069059183 10:63875947-63875969 CACTGGGTTCTACTTGAGGGGGG - Intergenic
1069101797 10:64331496-64331518 CACTGGGCTCTCCTTGAGGGTGG - Intergenic
1069320914 10:67170602-67170624 CACTGGACTCTTCTTGAGGGTGG + Intronic
1070806749 10:79275281-79275303 TACTGTCCTCCTTTTGAGGGTGG + Intronic
1070871123 10:79754442-79754464 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1071144874 10:82556798-82556820 CACTGGGATCTACTTCAGGGTGG - Intronic
1071343545 10:84669925-84669947 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1071638057 10:87276650-87276672 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1071657187 10:87461302-87461324 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1072715923 10:97752682-97752704 TGCTGGGATCCTCTTGTGGGGGG + Intronic
1074239846 10:111627251-111627273 CACTGGGATCTACTTGAGGGTGG + Intergenic
1075170845 10:120112283-120112305 CACTGGCATCCTCTCTATGGTGG - Intergenic
1075711299 10:124532084-124532106 CACTGGCAGCCCCTTCAGGCTGG + Intronic
1076967539 11:103008-103030 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1077852722 11:6089756-6089778 CACTGAGATCTACTTGAGGGTGG - Intergenic
1078851816 11:15171200-15171222 CTCTGGCATCCTCTGAATGGAGG - Intronic
1079663767 11:23076833-23076855 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1080195906 11:29608458-29608480 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1080398636 11:31913535-31913557 CACTGGGATACCCTTGAGGGTGG - Intronic
1080777372 11:35398495-35398517 CACTGGGGTCTACTTGAGGGTGG + Intronic
1081046666 11:38281920-38281942 CACTGGAATCTACTTGAGGGTGG + Intergenic
1081307551 11:41532015-41532037 CCCTGTCATCCTCTTCAGTGTGG - Intergenic
1082712065 11:56565108-56565130 CACTGGGGTCTTCTTGAGGGGGG - Intergenic
1083511806 11:63215777-63215799 CACTGGGGTCCACTTGAGAGGGG - Intronic
1083711276 11:64550496-64550518 CACTGGGGCCCACTTGAGGGTGG - Intergenic
1084586450 11:70065491-70065513 CACTGGGATCCTCTGCTGGGAGG - Intergenic
1084677142 11:70642084-70642106 CACTGGCATTCCCCTGAGGGAGG + Intronic
1085464027 11:76712314-76712336 CACTGGCATCATCCTGCAGGAGG - Intergenic
1085678903 11:78552151-78552173 CACTGGTGTCTTCCTGAGGGGGG - Intronic
1086288966 11:85283070-85283092 CACTGGCACCTACTAGAGGGTGG + Intronic
1086568651 11:88257350-88257372 CACTGGGGTCTACTTGAGGGCGG - Intergenic
1086740329 11:90360057-90360079 CACTGAGGTCTTCTTGAGGGTGG - Intergenic
1086823957 11:91472011-91472033 CACTGGGACCTACTTGAGGGTGG - Intergenic
1087059720 11:93965679-93965701 CACTGGGACCCACTCGAGGGTGG - Intergenic
1087413831 11:97826594-97826616 CACTGGGGCCATCTTGAGGGTGG + Intergenic
1087959064 11:104325654-104325676 CACTGGGGTCCACTTGAGGATGG + Intergenic
1088420364 11:109638369-109638391 CCCTGGGATCTACTTGAGGGGGG - Intergenic
1088843533 11:113646434-113646456 GACTGGCATCTGCTGGAGGGTGG - Intergenic
1090255327 11:125279719-125279741 CACTGGCATCCTACTCTGGGTGG - Intronic
1090538025 11:127667387-127667409 CACTGGGGTCTGCTTGAGGGTGG + Intergenic
1091221359 11:133931583-133931605 CACAGGCACCCTCGTGAGGCCGG + Intronic
1091681158 12:2528098-2528120 CTCTGGCATCCTGTTGGGAGAGG - Intronic
1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG + Intronic
1092443721 12:8533677-8533699 CACTGGAGTCTACTTGAGGGCGG + Exonic
1092724385 12:11470783-11470805 CACTGGCGTCTACTTGAGGGTGG + Intronic
1092764855 12:11843263-11843285 CACAGGCATCCTCCTTAGGCAGG + Intronic
1094171120 12:27493163-27493185 CACTGGGGTCTACTTGAGGGTGG + Intronic
1094485052 12:30918712-30918734 CACTGGGGTCTTCTTGAGGGTGG - Intergenic
1094759330 12:33512325-33512347 CACTGGGATCTACTTGGGGGTGG - Intergenic
1095620069 12:44242297-44242319 CACTGGGGTCTACTTGAGGGTGG - Intronic
1095728731 12:45481076-45481098 CACTGGGGCCCACTTGAGGGTGG - Intergenic
1095943340 12:47740138-47740160 CACCAGCAGCCTCTCGAGGGCGG + Exonic
1096493800 12:52027484-52027506 CACTGGCAGCCTCTGGATGCTGG + Intronic
1097292888 12:57934072-57934094 CACTGGGGTCTGCTTGAGGGTGG - Intergenic
1098308764 12:69127172-69127194 CACTGGGATCTTCTTGGGGGTGG - Intergenic
1098872188 12:75828905-75828927 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1099372036 12:81846102-81846124 CACTGGGGCCTTCTTGAGGGTGG - Intergenic
1099860052 12:88215008-88215030 CACTGGAGTCTACTTGAGGGTGG + Intergenic
1100001772 12:89845189-89845211 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1100179877 12:92073662-92073684 CACTGGGACCTACTTGAGGGTGG - Intronic
1100748427 12:97670850-97670872 CTCTGACATCCTCTTGAATGTGG + Intergenic
1101806750 12:108070678-108070700 CACTGGGATCTACTTGAGGGTGG - Intergenic
1102558213 12:113742766-113742788 CACTGCCTCCCTCTTGACGGAGG - Intergenic
1103141622 12:118553690-118553712 CACTGGGGTCTGCTTGAGGGTGG + Intergenic
1104225498 12:126828683-126828705 CACTGGTATCTACTTGAGGGTGG + Intergenic
1104442829 12:128808825-128808847 CACGGCGATCCTCTTCAGGGAGG + Exonic
1106742032 13:32654692-32654714 CACCAGCATCTTCTTGACGGTGG - Intronic
1108263689 13:48682885-48682907 CACTGGCATCTACTTGAGGGTGG - Intronic
1109881020 13:68476574-68476596 CTCTGCCATCCTCTTGTGGAGGG - Intergenic
1110063041 13:71066098-71066120 CACTGGCTTCTACTTGAGGGTGG + Intergenic
1110313395 13:74076802-74076824 CACTGGGGTCGACTTGAGGGTGG - Intronic
1110421183 13:75310808-75310830 CACCGGGACCCCCTTGAGGGTGG - Intronic
1113182826 13:107650907-107650929 CACTGGCGTCTACTTGACGGGGG + Intronic
1113227461 13:108175083-108175105 CACTGGGGTCTGCTTGAGGGTGG + Intergenic
1113242944 13:108360091-108360113 CACTGGAATCATCTCGGGGGAGG + Intergenic
1113247801 13:108417974-108417996 CACTGGGACCTACTTGAGGGTGG - Intergenic
1113363254 13:109651535-109651557 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1113952590 13:114080191-114080213 CACAGGAGTCCTCTTGAGGGAGG - Intronic
1113988249 13:114336815-114336837 CACTGGGGTCTACTTGAGGGGGG + Intergenic
1114249205 14:20943419-20943441 CACTGGCATCACCTTCAGGTAGG + Intergenic
1116107808 14:40533068-40533090 CACTGGGATCTTTTGGAGGGCGG + Intergenic
1116252931 14:42509972-42509994 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1117272045 14:54154642-54154664 CACTGGGGCCCACTTGAGGGTGG - Intergenic
1117310253 14:54514602-54514624 TACTGGGATCCACCTGAGGGTGG - Intronic
1118124951 14:62891390-62891412 CACTGGGGTCTACTTGAGGGTGG + Intronic
1118215034 14:63800793-63800815 CACTGTGATCTACTTGAGGGTGG + Intergenic
1118296961 14:64579096-64579118 CACTGGGGTCCACTTGAGGTGGG + Intronic
1118901995 14:69993878-69993900 CCCTGGCACTCTCTTGATGGAGG + Intronic
1119106873 14:71932811-71932833 GACCGGCAGCCTCTTGGGGGCGG - Exonic
1119115987 14:72021935-72021957 CACTGGGGTCTACTTGAGGGTGG - Intronic
1119194097 14:72704170-72704192 AACTGGCATCCCTTTCAGGGTGG + Intronic
1121684671 14:95826874-95826896 CACTGGCTTCATCCTAAGGGTGG + Intergenic
1122014657 14:98784378-98784400 CACTGGCATTCCCAGGAGGGAGG - Intergenic
1122810446 14:104285118-104285140 CACTCCCGTCCTATTGAGGGAGG + Intergenic
1123995273 15:25713765-25713787 CACTGACATCCTCTTGCGGACGG + Exonic
1124122625 15:26903116-26903138 CACTGGAGCCTTCTTGAGGGTGG - Intronic
1124228252 15:27916178-27916200 CACTGGAGTCTACTTGAGGGTGG + Intronic
1124447849 15:29754353-29754375 CACTGGGGTCTACTTGAGGGGGG + Intronic
1124567420 15:30828871-30828893 CAGTGGCAGCCTCTTCAGTGTGG + Intergenic
1125382831 15:39105238-39105260 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1126507164 15:49418628-49418650 TACTGGGGTCCACTTGAGGGTGG + Intronic
1126605150 15:50468709-50468731 CACTGGGGTCTACTTGAGGGGGG - Intronic
1127330537 15:57934790-57934812 CACTGGAGTCCACTAGAGGGTGG - Intergenic
1127574881 15:60281700-60281722 CAGGTGCATCCTCTTAAGGGTGG - Intergenic
1130059189 15:80557438-80557460 CACTGGGGTCTACTTGAGGGTGG + Intronic
1130189262 15:81716460-81716482 CACTGGGACCTACTTGAGGGTGG - Intergenic
1130996640 15:88907868-88907890 CCCTGGCTTCCTCAGGAGGGTGG + Intronic
1133710908 16:8400356-8400378 CACTGGGGTCCACTTGAGGGGGG + Intergenic
1134391903 16:13827738-13827760 CACTGGCACCTTCTTGAGGGTGG - Intergenic
1134766671 16:16764866-16764888 CACTGGGACCTGCTTGAGGGAGG - Intergenic
1136601381 16:31292420-31292442 CACTGGGGTCTACTTGAGGGTGG - Intronic
1137375781 16:47950546-47950568 CACTGGGACCGACTTGAGGGTGG - Intergenic
1138563553 16:57816355-57816377 TCCTGGCTTCCTCTTGAGGAAGG + Intronic
1138659970 16:58511138-58511160 CACTGGCATCCTCTTGAGGGAGG + Intronic
1138822898 16:60283000-60283022 CAGTGGCTTCCTCTGGAGGAGGG + Intergenic
1138848793 16:60600708-60600730 CAATGGGATCTACTTGAGGGTGG - Intergenic
1140561548 16:75988019-75988041 CACTGGGGTCCACTTGAGAGTGG - Intergenic
1140847536 16:78904655-78904677 CACTGGCACCTTTTTGAGAGAGG + Intronic
1141851488 16:86649321-86649343 CTCTGGCATCCTCTTGGATGGGG + Intergenic
1142180754 16:88668397-88668419 CACGGGGGTCCACTTGAGGGGGG - Intergenic
1142222731 16:88863605-88863627 CACTGGCCCCCTCTTGGCGGGGG - Exonic
1142453143 16:90196135-90196157 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1143538754 17:7557462-7557484 CCCAGGCAGCCTCTAGAGGGAGG - Exonic
1143558404 17:7676699-7676721 CACTGGCATGGTGTTGGGGGAGG - Intronic
1143710539 17:8731735-8731757 TACTGGGATCTGCTTGAGGGTGG + Intronic
1143712134 17:8742392-8742414 GACTGGCATCCCGCTGAGGGAGG + Intronic
1144710697 17:17399659-17399681 CTCTGGCCTCATCCTGAGGGAGG - Intergenic
1148395792 17:47307154-47307176 CACTGGGACCTACTTGAGGGTGG - Intronic
1148786547 17:50148796-50148818 CTCTGGCAGCCTCTGGAGGAAGG + Intronic
1149114356 17:53073970-53073992 CACTGGGATCTTCTTGAGGGTGG - Intergenic
1150057146 17:62028377-62028399 CACTGGGGTCTACTTGAGGGTGG + Intronic
1150283188 17:63941101-63941123 CTCGTGCTTCCTCTTGAGGGTGG + Exonic
1150423748 17:65060053-65060075 CACTGGGACCTACTTGAGGGTGG + Intergenic
1150493991 17:65593279-65593301 CACTGCCATCCGTATGAGGGGGG + Intronic
1151143929 17:72021169-72021191 CACTGGGATCTACTAGAGGGTGG - Intergenic
1151928374 17:77214986-77215008 CTCTCGCATCCACTTCAGGGTGG + Intronic
1152054408 17:78012325-78012347 CACTGGGTTCTCCTTGAGGGTGG + Intronic
1154114728 18:11602864-11602886 CACTAGGACCCACTTGAGGGTGG + Intergenic
1154179079 18:12114121-12114143 CACTGGCACCTTCTGGAAGGTGG + Intronic
1155090776 18:22507991-22508013 CACTGGAACCTACTTGAGGGTGG + Intergenic
1156715378 18:40002706-40002728 CACTGGGATCTACTTGAAGGTGG + Intergenic
1156928492 18:42612261-42612283 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1157237226 18:45976182-45976204 CACTGGGATCTGTTTGAGGGTGG + Intergenic
1159485114 18:69045763-69045785 CACTGGGACCTACTTGAGGGTGG - Intronic
1159524512 18:69570025-69570047 CACTGGGATCTACTTGAGGGAGG + Intronic
1161592683 19:5135848-5135870 CACTGGCATCTTCTGGATGCTGG - Intronic
1163115209 19:15185010-15185032 CACTGACGTCCTGTTGGGGGTGG + Exonic
1163647046 19:18495431-18495453 CACTCGCATCCCCATCAGGGAGG + Intronic
1167894299 19:52568883-52568905 AACTAGCATCATCCTGAGGGAGG - Intronic
1167924057 19:52809461-52809483 CACTGGCGTCTACTTGAGGGTGG + Intronic
1167995688 19:53400154-53400176 CACTGGCGTCTACTTGAGGGTGG - Intronic
924959623 2:22258-22280 CACTGGGGTCTGCTTGAGGGGGG - Intergenic
925493167 2:4418413-4418435 CACTGGGGCCCACTTGAGGGTGG + Intergenic
927307785 2:21593549-21593571 CCAGGGCATCCTCTTCAGGGTGG - Intergenic
927840072 2:26435578-26435600 CACTGGGGCCCACTTGAGGGTGG - Intronic
928372422 2:30750290-30750312 CACTGGGATCTACTTGAGTGGGG + Intronic
928470648 2:31572287-31572309 CACTGGGGTCTACTTGAGGGTGG + Intronic
928920944 2:36526689-36526711 CTCTGGCAGCTTCTGGAGGGGGG + Intronic
929114714 2:38434459-38434481 CACTGGCATCCTCTAGGGCCAGG + Intergenic
929763515 2:44825548-44825570 CCCTGGGCTCCTCTTGAGAGGGG - Intergenic
930365612 2:50435787-50435809 CACTGGGGCCTTCTTGAGGGTGG + Intronic
930450497 2:51530626-51530648 CACTGGGGTCTTCTTGAGGGTGG - Intergenic
930676980 2:54213097-54213119 CACTAGCGACCACTTGAGGGTGG - Intronic
931546762 2:63396821-63396843 CACTGGGGTCTACTTGAGGGTGG - Intronic
931547308 2:63403257-63403279 CACTGGGGTCTACTTGAGGGAGG + Intronic
932222570 2:70011090-70011112 CACTGGGACCTCCTTGAGGGTGG + Intergenic
935182198 2:100701247-100701269 CACTGGCCTCCCCTAAAGGGTGG + Intergenic
936043102 2:109164794-109164816 CACTGGCACCCTATTGAGCCAGG + Intronic
936791242 2:116155818-116155840 CACTGGGATCTACTTGAGGTTGG - Intergenic
937032242 2:118750389-118750411 CCATGGCCTCCACTTGAGGGAGG - Intergenic
937190196 2:120088418-120088440 CACTGGGATCTACTTGAGTGGGG + Intronic
937733575 2:125262377-125262399 CACTGGCTTCCTTTTGTGGATGG - Intergenic
938997203 2:136692718-136692740 CACTGGCAGCTGATTGAGGGTGG + Intergenic
939197709 2:138992605-138992627 CACTGGGGTCTACTTGAGGGTGG + Intergenic
939335596 2:140823919-140823941 CACTGGATTCTACTTGAGGGTGG + Intronic
939362644 2:141193571-141193593 CACTGGAGTCTACTTGAGGGTGG + Intronic
940374875 2:152946416-152946438 CACTGGCATCTGCTTCTGGGAGG - Intergenic
941418991 2:165258918-165258940 CACTGGGACCTACTTGAGGGAGG + Intronic
941541401 2:166790157-166790179 CACTGGTGTCTACTTGAGGGGGG - Intergenic
941929392 2:170925048-170925070 CACTACCATCCACTTGTGGGGGG + Intergenic
942016274 2:171820057-171820079 CACTGGGGTCTACTTGAGGGAGG + Intronic
942523977 2:176833339-176833361 CACTGGGGTCTACTTGAGGGTGG + Intergenic
942719524 2:178935280-178935302 CACTGGGGTCTTCTTGAGGGTGG - Intronic
943355356 2:186848992-186849014 CACTGGCTTCCTGCTGAGGGAGG - Exonic
944194253 2:197035847-197035869 CCCTGGGATCCTCTGAAGGGAGG - Intronic
944269539 2:197765851-197765873 CACTGGGGTCTACTTGAGGGTGG - Intronic
944336057 2:198536628-198536650 CACTGGGGCCCACTTGAGGGTGG + Intronic
944573453 2:201068459-201068481 CACTGGCTTCCACTTCAGAGTGG - Intronic
944576362 2:201094865-201094887 CACTGGGATCTACTTGAAGGTGG + Intergenic
944943254 2:204653103-204653125 CACTGGGATCTTCTTGAAGGTGG + Intronic
946594137 2:221287548-221287570 CACTGGAGTCTACTTGAGGGTGG + Intergenic
946820925 2:223628353-223628375 AACTGGCATCATCTTGAGTGTGG - Intergenic
947198098 2:227589074-227589096 CACTGGAGTCTACTTGAGGGTGG - Intergenic
948534446 2:238635557-238635579 CACTGGGGTCTACTTGAGGGTGG - Intergenic
948580293 2:238982732-238982754 CACTGGGATCCATTGGAGGGTGG - Intergenic
949084581 2:242140800-242140822 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1169065288 20:2691766-2691788 CACTCCCATCCTCTTCTGGGGGG - Intergenic
1170108644 20:12780543-12780565 CACTGGGACCTACTTGAGGGTGG - Intergenic
1170143242 20:13146260-13146282 CACTGGGATCTGCTTGAGGGAGG + Intronic
1171263769 20:23753781-23753803 CACTGGCATGCACTGCAGGGAGG + Intergenic
1171401104 20:24873427-24873449 CTCTGGTGTCCTCTGGAGGGAGG + Intergenic
1171779092 20:29402514-29402536 CACTGGGGTCTACTTGAGGGGGG + Intergenic
1171977518 20:31605029-31605051 CACTGGGCTCCTCTGGAAGGAGG - Intergenic
1172785636 20:37466532-37466554 CAGGGCCATCCTCTTGAGGTGGG + Intergenic
1173559883 20:43995668-43995690 CACTGGGTTCTACTTGAGGGTGG - Intronic
1173931656 20:46825857-46825879 CACTGGGATCTACTTGGGGGGGG + Intergenic
1175282356 20:57812469-57812491 TACTGGGACCCACTTGAGGGTGG - Intergenic
1175892597 20:62322159-62322181 CACTGGCAGCCTGTGGTGGGGGG + Exonic
1176281161 20:64313294-64313316 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1176285799 21:5018886-5018908 CATGGGCATCCTTTGGAGGGTGG - Intergenic
1176341675 21:5704196-5704218 CACCACCATCCTCTTGAAGGTGG + Intergenic
1176473929 21:7136348-7136370 CACCACCATCCTCTTGAAGGTGG + Intergenic
1176503152 21:7620260-7620282 CACCACCATCCTCTTGAAGGTGG - Intergenic
1176535996 21:8102265-8102287 CACCACCATCCTCTTGAAGGTGG + Intergenic
1178203448 21:30435722-30435744 CACTGGGATCTACTTGAGGGAGG - Intergenic
1178362978 21:31965282-31965304 CACTGGGGCCCACTTGAGGGTGG + Intronic
1179871382 21:44244589-44244611 CATGGGCATCCTTTGGAGGGTGG + Intergenic
1182263121 22:29090365-29090387 CACTGGGGTCTACTTGAGGGTGG + Intronic
1183522315 22:38302775-38302797 CTCTGGCATCCTCTGGGGGCAGG + Intronic
1203240945 22_KI270733v1_random:18662-18684 CACCACCATCCTCTTGAAGGTGG + Intergenic
950356047 3:12410145-12410167 CAGTTCCATCCTATTGAGGGCGG - Intronic
950909537 3:16574666-16574688 CACTGGGGTCCACTTGATGGGGG + Intergenic
951008610 3:17649304-17649326 CACTGGCGTCTACTTGAGGGTGG + Intronic
952228095 3:31399932-31399954 CACTGGGATCTGCTTGAGGGTGG - Intergenic
953079641 3:39603756-39603778 CATTGGGACCTTCTTGAGGGTGG - Intergenic
953225859 3:41019871-41019893 CACTGGGGCCCACTTGAGGGTGG + Intergenic
953783423 3:45892544-45892566 CACTGGGACCCCCTTGAGGATGG + Intronic
954954241 3:54505222-54505244 AACTGTGAACCTCTTGAGGGAGG - Intronic
955141216 3:56271766-56271788 CACTGGGACCTACTTGAGGGTGG - Intronic
955442141 3:58967867-58967889 CACTGGGGTCTACTTGAGGGTGG - Intronic
956236110 3:67072677-67072699 CACTGGCGTCTGCTTGATGGTGG - Intergenic
956942608 3:74181075-74181097 CACTGGAATCTATTTGAGGGTGG + Intergenic
957086053 3:75678154-75678176 CACTGGGGTCTACTTGAGGGGGG - Intergenic
957746487 3:84349515-84349537 CACTGGGGTCTACTTGAGGGTGG + Intergenic
959098336 3:101981841-101981863 CACTGGGGTCTACTTGAGGGTGG - Intergenic
959482784 3:106893976-106893998 CACTGGAGTCTACTTGAGGGAGG + Intergenic
960782679 3:121337080-121337102 CACTGGGGTCTACTTGAGGGTGG + Intronic
962451725 3:135524354-135524376 CACTGGGGTCTACTTGAGGGTGG + Intergenic
962881882 3:139586208-139586230 CACTGGGGTCTACTTGAGGGTGG + Intronic
963609325 3:147445145-147445167 CACTGGGCTCCACTTGAGGGTGG - Intronic
963674399 3:148290942-148290964 CACTGGGGTCTCCTTGAGGGTGG + Intergenic
963925914 3:150951127-150951149 CACTGGGATCTTCTTGAGGATGG + Intronic
964529866 3:157655856-157655878 CACTGGGGTCTACTTGAGGGTGG - Intronic
964868440 3:161287533-161287555 CACTGGGACCTACTTGAGGGTGG + Intergenic
964979673 3:162664499-162664521 CACTGGGATCTACTTGAGGGTGG + Intergenic
965009490 3:163067533-163067555 CACTGGGATCTACTTGAGGGAGG + Intergenic
965058813 3:163755869-163755891 CACTGGGGTCTACTTGAGGGTGG + Intergenic
965563233 3:170081731-170081753 CACTGGGGTCTACTTGAGGGAGG - Intronic
965742241 3:171887674-171887696 CACTGGTGTCTACTTGAGGGTGG - Intronic
965934232 3:174087105-174087127 CACTGGAGCCCACTTGAGGGTGG + Intronic
966453540 3:180089846-180089868 CACTGGGGTCTACTTGAGGGTGG - Intergenic
966671780 3:182535333-182535355 CACTGGGGTCTACTTGAGGGTGG - Intergenic
966691773 3:182748841-182748863 CACTGGGACCCATTTGAGGGTGG + Intergenic
967374312 3:188783539-188783561 CACTGGGATCTACTTGAGGGTGG + Intronic
968053596 3:195673738-195673760 CACAGACACCCTGTTGAGGGAGG + Intergenic
968102217 3:195974624-195974646 CACAGACACCCTGTTGAGGGAGG - Intergenic
968250869 3:197212071-197212093 CACTGGGATCTACTTGAGGGTGG + Intronic
969701728 4:8771356-8771378 TCCTGGCATCCTCGTGGGGGAGG - Intergenic
969896933 4:10313985-10314007 CACTGGCATCTGCTTCTGGGAGG - Intergenic
970010432 4:11452914-11452936 CACTGGGTTCTACTTGAGGGTGG - Intergenic
970124168 4:12790692-12790714 CACTGGCGTCTACTTTAGGGTGG - Intergenic
970298258 4:14654629-14654651 CACTGGGGCCCACTTGAGGGTGG + Intergenic
970375173 4:15450008-15450030 CACTGGGGTCTACTTGAGGGTGG + Intergenic
970692223 4:18632855-18632877 CACTGGGACCTACTTGAGGGAGG + Intergenic
970745465 4:19289478-19289500 GACTGGGATCTACTTGAGGGTGG - Intergenic
971390398 4:26180157-26180179 CACTGGGATCTTTTTGAGGGTGG + Intronic
971521153 4:27552073-27552095 CACTGGGATCTACTTGAGGGTGG - Intergenic
971539501 4:27798078-27798100 CACTGGGATCTATTTGAGGGTGG + Intergenic
971901168 4:32659557-32659579 CACTGGCACCTACTCGAGGGTGG - Intergenic
972618497 4:40723259-40723281 CACTGGCAACTTGCTGAGGGAGG - Intergenic
972659752 4:41104657-41104679 TACTGGGACCCACTTGAGGGAGG - Intronic
973151631 4:46895473-46895495 CACTGGGACCTACTTGAGGGTGG + Intronic
973838779 4:54839726-54839748 CACTGGGATCTGCTTGAGGGTGG + Intergenic
973977292 4:56275114-56275136 CACTGGAATCTACTTGAGTGTGG + Intronic
974184183 4:58425146-58425168 CACTGGGGTGTTCTTGAGGGTGG - Intergenic
974515303 4:62900355-62900377 CACTGGGACCTACTTGAGGGTGG + Intergenic
974944191 4:68506180-68506202 CACTGGGGTCTACTTGAGGGTGG + Intergenic
974954739 4:68623493-68623515 CACTGGGGTCTACTTGAGGGTGG + Intronic
975274024 4:72473903-72473925 CACTGACATCATGTTGAGGATGG - Intronic
975719358 4:77234950-77234972 CACTGGCAGTCTCTTGGGGGGGG + Intronic
975835997 4:78422701-78422723 CACTGGGTTCCTCTTGATGTTGG - Intronic
976015841 4:80553158-80553180 CACTGGGGTCTACTTGAGGGTGG - Intronic
977001919 4:91515364-91515386 CACTGGGATCTACTTGAGGATGG - Intronic
978593261 4:110349712-110349734 CACTGGTGTCTACTTGAGGGTGG - Intergenic
979124458 4:116950018-116950040 CATTGCCAGCCACTTGAGGGTGG + Intergenic
979262011 4:118659032-118659054 CACTGGGGTCTACTTGAGGGTGG - Intergenic
979780322 4:124643920-124643942 CACTGGAGTCTACTTGAGGGTGG + Intergenic
980024224 4:127745963-127745985 CATTGGGATCTACTTGAGGGTGG - Intronic
980302979 4:131017822-131017844 CACTGGAGTCCACTTGATGGGGG - Intergenic
981495863 4:145391551-145391573 CACTGGGTTCTACTTGAGGGTGG + Intergenic
981834183 4:149036187-149036209 CACTGGGGTCTACTTGAGGGTGG - Intergenic
981991420 4:150925480-150925502 CACTAGACTCCTCTTGAGGTTGG + Intronic
982162322 4:152582809-152582831 CACTGGAATCTACTTGAGGATGG + Intergenic
983447288 4:167869500-167869522 CACTGGGGTCTACTTGAGGGTGG - Intergenic
984037653 4:174690665-174690687 CACTGGCATCTACTTGAGGTGGG - Intronic
985516840 5:350663-350685 CACTGGCATCCCCTGGCTGGAGG - Intronic
985623834 5:973305-973327 CACTGGGATCTACCTGAGGGGGG + Intergenic
985762914 5:1760816-1760838 CCCTGGCAGCCTCATGGGGGAGG + Intergenic
986687825 5:10289564-10289586 TCCTGGCAGCCCCTTGAGGGAGG - Intronic
986984844 5:13488839-13488861 CACTGGCGCCTACTTGAGGGTGG - Intergenic
987018558 5:13846291-13846313 CACTGGGGTCTACTTGAGGGTGG - Intronic
987378919 5:17265581-17265603 CACTGAAATCCTCTTAATGGTGG + Intronic
987756720 5:22106113-22106135 CACTGGGTTCTACTTGAGGGTGG + Intronic
987880438 5:23737277-23737299 CACTGGGATCTGCTTGAGTGGGG - Intergenic
988097992 5:26642460-26642482 CACTGGGACCTACTTGAGGGTGG + Intergenic
988154733 5:27436310-27436332 CATTAGCATGATCTTGAGGGTGG + Intergenic
988978842 5:36543428-36543450 CACTGGGGTCTTCTTGAGGGTGG - Intergenic
989538618 5:42592422-42592444 CACTGGCACCCACTTGGGGGTGG - Intronic
989696721 5:44210461-44210483 CACTGGCGTCCACTTGAGGGTGG - Intergenic
990336961 5:54783829-54783851 CACTGGGTTCTACTTGAGGGGGG + Intergenic
990497309 5:56361451-56361473 CACTGGGACCTACTTGAGGGTGG - Intergenic
991134109 5:63161129-63161151 CACTGGCGTCTTCTTGAAAGCGG + Intergenic
991931319 5:71755689-71755711 CACTGTCATTCTCCTGTGGGTGG + Intergenic
992976207 5:82123350-82123372 CACTGGGTTCTACTTGAGGGTGG + Intronic
993413388 5:87598113-87598135 CACTGGGACCTACTTGAGGGTGG - Intergenic
993439010 5:87932239-87932261 CACTTGCAACTTCTTGAGGTGGG + Intergenic
993801425 5:92347630-92347652 CACTGGGATCTACTTGAGGGTGG - Intergenic
994263579 5:97688029-97688051 CACTGGGACCTTCTTCAGGGTGG + Intergenic
994467419 5:100155622-100155644 CACTGGGGTCTACTTGAGGGAGG - Intergenic
994558459 5:101334602-101334624 CACTGGGACCTTCTTGAGGGTGG + Intergenic
994601435 5:101910446-101910468 CACTAGGGTTCTCTTGAGGGTGG - Intergenic
994610230 5:102027357-102027379 CACTGGGATCTACTCGAGGGTGG + Intergenic
995429448 5:112058048-112058070 CACTGGGATCTACTTGACGGTGG + Intergenic
997045072 5:130306205-130306227 CACTGGTGTCTACTTGAGGGTGG + Intergenic
997609467 5:135204815-135204837 CACTGGGGTCTACTTGAGGGTGG - Intronic
997641862 5:135454513-135454535 CACTGGGGTCTACTTGAGGGTGG - Intergenic
999056038 5:148577802-148577824 CACTGGGGTCTACTTGAGGGTGG + Intronic
999057297 5:148592217-148592239 CACTGGAATCTACTTGAGGGTGG + Intronic
999104286 5:149056269-149056291 CACTGGGATCTACTTGAGGGTGG - Intronic
999702683 5:154242557-154242579 CACTGGGACCCTCTCCAGGGAGG - Intronic
1000276491 5:159740812-159740834 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1000678439 5:164152915-164152937 CACTAGGATCTACTTGAGGGTGG + Intergenic
1000759012 5:165197912-165197934 CACTGGGAACTGCTTGAGGGTGG + Intergenic
1000797813 5:165687587-165687609 CACTGGGAGCCTGTTGGGGGTGG - Intergenic
1001178876 5:169499636-169499658 CACTGGAATCTACTTGAGGGTGG - Intergenic
1001585061 5:172828196-172828218 CTCTGGCCTCGTCTTGAGGCAGG - Intergenic
1002732578 5:181352150-181352172 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1002751959 6:121957-121979 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1003455052 6:6274509-6274531 CACTGGCATCATCCTGAGACAGG - Intronic
1004034081 6:11904937-11904959 CACTGGGATCTACTTGAGGGTGG - Intergenic
1004059366 6:12177148-12177170 CACTGGGATCTACTTGAGGGTGG + Intergenic
1004538932 6:16530587-16530609 CACTGGAATCTACTGGAGGGTGG + Intronic
1004586824 6:17010726-17010748 CACTGGCGTCTACTTGAGGGTGG - Intergenic
1004749328 6:18544885-18544907 CACTGGAGTCTACTTGAGGGTGG - Intergenic
1004817612 6:19329632-19329654 CACTGGGTTCCACTTGAGGGTGG - Intergenic
1006044365 6:31281795-31281817 CACTGGGGTCCACTTGAGGGTGG + Intronic
1006053420 6:31361617-31361639 CACTGGGGTCCACTTGAGGGTGG + Intergenic
1006272069 6:32972434-32972456 CTTTGAAATCCTCTTGAGGGCGG - Exonic
1006456769 6:34136504-34136526 CACTGGCTTCTCCTTGAGGCCGG + Intronic
1007179827 6:39921937-39921959 CACTGGGACCTACTTGAGGGTGG - Intronic
1007195879 6:40059913-40059935 CACTGGAGTCTACTTGAGGGTGG + Intergenic
1007825359 6:44595785-44595807 CACTGGAATTTTCCTGAGGGAGG + Intergenic
1008265001 6:49414264-49414286 CATTGGCACCTACTTGAGGGTGG + Intergenic
1008736664 6:54552941-54552963 CTCTGGGATCTACTTGAGGGTGG + Intergenic
1009753624 6:67905114-67905136 CACTGGGGTCTACTTGAGGGGGG + Intergenic
1010143850 6:72643093-72643115 CACTGGAGTCTACTTGAGGGTGG + Intronic
1010173672 6:73001517-73001539 CATTGGGATGCTCTTGAAGGAGG + Intronic
1010523520 6:76872236-76872258 CACTGGGTTCTACTTGAGGGTGG - Intergenic
1010899420 6:81407881-81407903 CACTGGGATCTACTTGAGGGTGG - Intergenic
1012144288 6:95662113-95662135 CACTGGGACCTTTTTGAGGGTGG + Intergenic
1012337474 6:98078975-98078997 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1013316749 6:108950608-108950630 CACTGGGACCTACTTGAGGGTGG + Intronic
1013744240 6:113325959-113325981 CACTGGGATCTACTTGAGGGTGG + Intergenic
1014567584 6:122969282-122969304 CACTGGGGTCTTCTTGAGGTGGG - Intergenic
1015488034 6:133793952-133793974 CACTGGGACCAACTTGAGGGTGG - Intergenic
1016084695 6:139898731-139898753 CATTGGCACCTACTTGAGGGTGG - Intergenic
1017801007 6:157896814-157896836 CACTGCCAACCTATTGAGAGGGG - Exonic
1018461374 6:164002582-164002604 CACAGGCAACCTATTGAGGAAGG + Intergenic
1019099327 6:169615383-169615405 CACTGGGGTCTGCTTGAGGGTGG - Intronic
1019183059 6:170204375-170204397 CACTGGGACCTACTTGAGGGTGG - Intergenic
1019817180 7:3209898-3209920 CACTGGTGTCACCTTGAGGGTGG - Intergenic
1020586621 7:10078395-10078417 CACTGCCATCATTTTGATGGTGG - Intergenic
1020862407 7:13511273-13511295 CACTGGGATCTACTTGAGGGAGG - Intergenic
1021200510 7:17723799-17723821 CACTGGGATCTACTTGACGGGGG - Intergenic
1021426186 7:20502309-20502331 AACTGGGATCTACTTGAGGGTGG + Intergenic
1021750234 7:23791449-23791471 CACTGGGGTCTACTTGAGGGTGG + Intronic
1021967709 7:25937899-25937921 CACTGGTGTCTACTTGAGGGTGG + Intergenic
1022277897 7:28874044-28874066 CACTGGGGTCCTCGTGAGAGTGG + Intergenic
1022739079 7:33104289-33104311 CACTGGGGCCCACTTGAGGGTGG + Intronic
1023735169 7:43229460-43229482 CACTGGGATCTACTTGAGGGTGG + Intronic
1023896603 7:44438980-44439002 CACTGGCCTCCTCTTCACCGAGG - Intronic
1024228761 7:47348011-47348033 CACTTGCGTCCTGTGGAGGGTGG - Intronic
1024313372 7:47990933-47990955 CACTGAGATCTACTTGAGGGTGG + Intronic
1024848322 7:53677616-53677638 CACTGGGACCTTCTTGAGGGTGG - Intergenic
1024885144 7:54132840-54132862 CACTGGGATGTACTTGAGGGTGG - Intergenic
1025064874 7:55845077-55845099 CACTGGTGTCTACTTGAGGGTGG - Intronic
1027356851 7:77365392-77365414 CACTGGGGTCTTCTTGAGAGTGG - Intronic
1027429676 7:78097647-78097669 CACTGGTGTCTACTTGAGGGTGG + Intronic
1027887612 7:83929625-83929647 CACTGGCACTTACTTGAGGGTGG - Intergenic
1027894800 7:84026829-84026851 CACTGGACTCTACTTGAGGGTGG + Intronic
1027933474 7:84570552-84570574 CACTGGGATCTACTTGAGGTGGG - Intergenic
1028615131 7:92757310-92757332 CACTGGAGTCTACTTGAGGGTGG - Intronic
1029054430 7:97726368-97726390 CACTGGTGTCTGCTTGAGGGGGG - Intergenic
1029195153 7:98800289-98800311 CACTGGAGTCTACTTGAGGGTGG - Intergenic
1029341847 7:99951482-99951504 CACTGGGGTCTGCTTGAGGGTGG + Intergenic
1030417386 7:109262574-109262596 CACTGGTTTCTACTTGAGGGTGG - Intergenic
1030517435 7:110555528-110555550 TAATGTCCTCCTCTTGAGGGTGG + Intergenic
1031376309 7:121030793-121030815 TTCAGGCATCCACTTGAGGGGGG + Intronic
1032388861 7:131542801-131542823 TACTGCCATGCTCTAGAGGGAGG - Intronic
1033044136 7:137945793-137945815 CACCCGCCTCCTCATGAGGGTGG + Intronic
1033513689 7:142085490-142085512 CAGGGGCAGCCTCTTGAGGGAGG + Intronic
1033769629 7:144535162-144535184 CACTGGGGCCCACTTGAGGGTGG - Intronic
1033904300 7:146183182-146183204 GCCTGGCATCCTCTGGTGGGAGG - Intronic
1034156183 7:148957929-148957951 CACTGGGATCTGCTTGAGGGTGG - Intergenic
1034237503 7:149584046-149584068 CACTGGCACCTACTTGAGGGTGG - Intergenic
1034260479 7:149752438-149752460 CACTGGGAACATCTCGAGGGCGG - Intergenic
1034424370 7:151006930-151006952 CACTGGTGTCCTCTTGGCGGCGG + Exonic
1035195477 7:157216512-157216534 CACTGGGATCTACTTGAAGGGGG - Intronic
1035220559 7:157403925-157403947 CACTGGCTGTTTCTTGAGGGTGG + Intronic
1037028594 8:14072270-14072292 CAATGGCACCTACTTGAGGGTGG - Intergenic
1037261075 8:17009037-17009059 CACAGGCACCTACTTGAGGGTGG + Intergenic
1037404059 8:18522829-18522851 CACTGGCGCCTGCTTGAGGGTGG - Intergenic
1038233031 8:25723103-25723125 CACTGGGGTCTACTTGAGGGAGG - Intergenic
1038270660 8:26072632-26072654 CACTGGGTTCTACTTGAGGGTGG - Intergenic
1038817560 8:30920788-30920810 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1039342217 8:36663346-36663368 CACTGGGCTCTACTTGAGGGTGG - Intergenic
1039747581 8:40443189-40443211 CCATGCCATCCTCTAGAGGGAGG - Intergenic
1040843538 8:51810017-51810039 CAGTTGTATCCTCTTGAAGGAGG - Intergenic
1041013495 8:53567924-53567946 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1041075789 8:54168564-54168586 CACTGGTATCTACTTGAGGCTGG + Intergenic
1041220114 8:55642255-55642277 CATTGGGACCCTCTTGAGGCTGG - Intergenic
1041470628 8:58204470-58204492 CACTGGTATCTACTTAAGGGCGG - Intergenic
1041695245 8:60728975-60728997 CACTGGGGTCTACTTGAGGGTGG - Intronic
1042046298 8:64655994-64656016 CACTGGGGTCTACTTGAGGGTGG + Intronic
1042371935 8:68001926-68001948 CACTGGAGTCTACTTGAGGGCGG + Intronic
1042419276 8:68566318-68566340 CACTGGGTTCTACTTGAGGGTGG - Intronic
1042945385 8:74148976-74148998 AACTGGTAGCCTTTTGAGGGAGG + Intergenic
1043361661 8:79479635-79479657 CACTGGGATGTACTTGAGGGTGG + Intergenic
1043407820 8:79956638-79956660 CACTGGGGTCTACTTGAGGGTGG - Intronic
1043737958 8:83770527-83770549 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1044172130 8:89067311-89067333 CACTGGAGTCTACTTGAGGGTGG - Intergenic
1044871992 8:96628554-96628576 CACTGGCATCCTTTTAAGTCAGG + Intergenic
1045412950 8:101937347-101937369 CACTGGGTTCTACTTGAGGGTGG - Intronic
1046290736 8:112156600-112156622 CACTGGCGCCTACTTGAGGGTGG + Intergenic
1046499230 8:115054287-115054309 CACTGGGATCTACTTGAGGATGG - Intergenic
1046979743 8:120324055-120324077 CACTGGGACCTACTTGAGGGTGG + Intronic
1047162977 8:122402301-122402323 CACTGGGCTCTTCTTGAGGGTGG + Intergenic
1047264886 8:123297229-123297251 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1047595021 8:126369667-126369689 CACTGGGATCTTCTTGAGGGTGG - Intergenic
1048096737 8:131303846-131303868 CACTGGCGTCTACTTGAGAGGGG - Intergenic
1048153245 8:131914815-131914837 CACTGGGGCCCACTTGAGGGTGG - Intronic
1048723044 8:137348940-137348962 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1048847087 8:138612131-138612153 CAGTGGCTTCCTCTGGAGGGTGG + Intronic
1049137238 8:140914582-140914604 CACTGGGATTTACTTGAGGGTGG - Intronic
1049662004 8:143823665-143823687 CACTGGAATGCTCTGGAGGCGGG + Intronic
1049725586 8:144144232-144144254 CCATGGCATCCTCTCGAAGGAGG - Intergenic
1050181715 9:2930140-2930162 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1050801127 9:9615880-9615902 CACAGCCATCCTATTGAGAGAGG - Intronic
1052071453 9:24086772-24086794 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1052148845 9:25086694-25086716 CACTGGCATACTATTGAGGTTGG + Intergenic
1052393537 9:27909775-27909797 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1052856472 9:33410013-33410035 CACGGGGGTCTTCTTGAGGGCGG - Intergenic
1053315177 9:37045038-37045060 CACTGGAAGGCTCCTGAGGGTGG - Intergenic
1055133158 9:72798668-72798690 CACTGGGGTCTACTTGAGGGTGG + Intronic
1055482766 9:76726074-76726096 AACTGGCATCCTCTACACGGTGG + Intronic
1055877847 9:80964825-80964847 CACTGGAATTCTCTGGAGTGTGG + Intergenic
1056863404 9:90207874-90207896 CACTGGATCCCACTTGAGGGTGG - Intergenic
1057096217 9:92312483-92312505 CACTGGGGTCTACTTGAGGGTGG + Intronic
1057606293 9:96499782-96499804 GACTGGTGTCCTCTTGAGAGGGG + Intronic
1057910421 9:99015919-99015941 CCCTGGCAGCCTCATGAGCGAGG + Intronic
1058199027 9:102015425-102015447 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1058460989 9:105182371-105182393 CACTGGGCTCTACTTGAGGGTGG - Intergenic
1058669955 9:107352429-107352451 CACTGGGGTCTGCTTGAGGGTGG - Intergenic
1058833471 9:108839906-108839928 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1059925591 9:119206104-119206126 AACTGGTATCCTCTTAAGAGAGG + Intronic
1061264630 9:129497835-129497857 CTCAGGCACCCTCTTCAGGGAGG - Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062123507 9:134847160-134847182 GAGTGGCATCTCCTTGAGGGTGG - Intergenic
1062299166 9:135854927-135854949 CACTGGGGTCTCCTTGAGGGTGG - Intronic
1203457271 Un_GL000220v1:1749-1771 CACCACCATCCTCTTGAAGGTGG + Intergenic
1186947396 X:14584034-14584056 CACTGGGACCTACTTGAGGGTGG + Intronic
1187306537 X:18100199-18100221 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1188014199 X:25090083-25090105 CACTGGCGCCTACTTGAGGGTGG - Intergenic
1188471013 X:30539266-30539288 CACTGGGACCTACTTGAGGGTGG + Intergenic
1188645693 X:32564019-32564041 CACTGGGATCTACTTGAGGTGGG - Intronic
1188992582 X:36840697-36840719 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1189749303 X:44203312-44203334 CACTGCCATTCTGTTTAGGGAGG - Intronic
1189874049 X:45417055-45417077 CACTGGGGTCTACTTGAGGGAGG - Intergenic
1190418497 X:50204480-50204502 CACTTCCATCGTCTTGGGGGTGG + Intronic
1190513787 X:51202087-51202109 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1190905859 X:54727267-54727289 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1191818753 X:65278807-65278829 CACTGGGGTCTACTTGAGGGGGG - Intergenic
1192019426 X:67369555-67369577 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1192072033 X:67951116-67951138 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1192075789 X:67994727-67994749 CACTGGAATGTACTTGAGGGTGG - Intergenic
1192386262 X:70674057-70674079 CACTGGTGTCTACTTGAGGGTGG - Intronic
1192698774 X:73446609-73446631 CAAAGGCGTCCTCTTGATGGAGG + Intergenic
1193187061 X:78525967-78525989 CACTGGAGTCTACTTGAGGGTGG + Intergenic
1193294052 X:79813153-79813175 CACTAGAATCTACTTGAGGGTGG - Intergenic
1193405787 X:81100190-81100212 CACTGGGACCTACTTGAGGGTGG - Intergenic
1193428760 X:81373953-81373975 CACTGGGGCCCACTTGAGGGTGG - Intergenic
1193708294 X:84850028-84850050 CATTGGCATCTGCTTGAAGGTGG + Intergenic
1193710938 X:84878975-84878997 CATTGGCATCTGCTTGAAGGTGG - Intergenic
1193825379 X:86219467-86219489 CACTGGGGTCTACTTGAGGGTGG - Intronic
1193865719 X:86727764-86727786 CACTGGCATCTGCTTTGGGGAGG - Intronic
1194680238 X:96843268-96843290 CACTGGCATCTACTTCTGGGAGG - Intronic
1194780859 X:98024043-98024065 CACTGGGGTCTACTTGAGGGAGG - Intergenic
1195994122 X:110714169-110714191 CACTGGGGTCTTCTTGAGGATGG - Intronic
1196014836 X:110927734-110927756 CACTGGGGTCTACTTGAGGGTGG + Intergenic
1196472328 X:116042567-116042589 CACTGGGATCTACTTGAGGGTGG + Intergenic
1196932872 X:120698290-120698312 CACTGGCATCCCCAAAAGGGAGG + Intergenic
1197132102 X:123017442-123017464 CACTGGGGTGTTCTTGAGGGTGG - Intergenic
1197256770 X:124271931-124271953 CACTGGAGTCTACTTGAGGGTGG + Intronic
1198076579 X:133199061-133199083 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1198383843 X:136108920-136108942 CACTGGGGTCTACTTGAGGGTGG - Intergenic
1198617368 X:138474164-138474186 CACTGGCATTCTTGAGAGGGGGG - Intergenic
1199306551 X:146273537-146273559 CACTGGAGTCTACTTGAGGGAGG - Intergenic
1199310688 X:146316462-146316484 CACTGGGACCTACTTGAGGGAGG + Intergenic
1200330066 X:155286137-155286159 CACTGGGGTGTTCTTGAGGGTGG - Intronic
1201248257 Y:12028710-12028732 CACTGGGTTCTACTTGAGGGGGG + Intergenic
1201384301 Y:13421748-13421770 CACTGGGATCTACTTGAGAGTGG + Intronic
1201399481 Y:13589214-13589236 CACTGGCACCTACTTGAGGGTGG + Intergenic
1201980584 Y:19905235-19905257 CACTGGTACCTTCTTGAGGGTGG - Intergenic