ID: 1138670463

View in Genome Browser
Species Human (GRCh38)
Location 16:58610274-58610296
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179679
Summary {0: 15, 1: 832, 2: 12470, 3: 48626, 4: 117736}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138670463_1138670468 16 Left 1138670463 16:58610274-58610296 CCAGGCATGGTGGTAGACACCTG 0: 15
1: 832
2: 12470
3: 48626
4: 117736
Right 1138670468 16:58610313-58610335 GAGAATCGCTTAAACGCAGGAGG 0: 5
1: 882
2: 29355
3: 98780
4: 161337
1138670463_1138670469 19 Left 1138670463 16:58610274-58610296 CCAGGCATGGTGGTAGACACCTG 0: 15
1: 832
2: 12470
3: 48626
4: 117736
Right 1138670469 16:58610316-58610338 AATCGCTTAAACGCAGGAGGTGG 0: 1
1: 553
2: 18515
3: 63175
4: 101954
1138670463_1138670467 13 Left 1138670463 16:58610274-58610296 CCAGGCATGGTGGTAGACACCTG 0: 15
1: 832
2: 12470
3: 48626
4: 117736
Right 1138670467 16:58610310-58610332 TCAGAGAATCGCTTAAACGCAGG 0: 1
1: 1
2: 24
3: 774
4: 10919
1138670463_1138670470 22 Left 1138670463 16:58610274-58610296 CCAGGCATGGTGGTAGACACCTG 0: 15
1: 832
2: 12470
3: 48626
4: 117736
Right 1138670470 16:58610319-58610341 CGCTTAAACGCAGGAGGTGGAGG 0: 1
1: 214
2: 8097
3: 38252
4: 90164
1138670463_1138670471 23 Left 1138670463 16:58610274-58610296 CCAGGCATGGTGGTAGACACCTG 0: 15
1: 832
2: 12470
3: 48626
4: 117736
Right 1138670471 16:58610320-58610342 GCTTAAACGCAGGAGGTGGAGGG 0: 1
1: 2
2: 158
3: 545
4: 1399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138670463 Original CRISPR CAGGTGTCTACCACCATGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr