ID: 1138670464

View in Genome Browser
Species Human (GRCh38)
Location 16:58610293-58610315
Sequence CTCTGAGTAGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466644
Summary {0: 348, 1: 4384, 2: 66014, 3: 156492, 4: 239406}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138670464_1138670470 3 Left 1138670464 16:58610293-58610315 CCTGTAATCCCAGCTACTCAGAG 0: 348
1: 4384
2: 66014
3: 156492
4: 239406
Right 1138670470 16:58610319-58610341 CGCTTAAACGCAGGAGGTGGAGG 0: 1
1: 214
2: 8097
3: 38252
4: 90164
1138670464_1138670467 -6 Left 1138670464 16:58610293-58610315 CCTGTAATCCCAGCTACTCAGAG 0: 348
1: 4384
2: 66014
3: 156492
4: 239406
Right 1138670467 16:58610310-58610332 TCAGAGAATCGCTTAAACGCAGG 0: 1
1: 1
2: 24
3: 774
4: 10919
1138670464_1138670471 4 Left 1138670464 16:58610293-58610315 CCTGTAATCCCAGCTACTCAGAG 0: 348
1: 4384
2: 66014
3: 156492
4: 239406
Right 1138670471 16:58610320-58610342 GCTTAAACGCAGGAGGTGGAGGG 0: 1
1: 2
2: 158
3: 545
4: 1399
1138670464_1138670468 -3 Left 1138670464 16:58610293-58610315 CCTGTAATCCCAGCTACTCAGAG 0: 348
1: 4384
2: 66014
3: 156492
4: 239406
Right 1138670468 16:58610313-58610335 GAGAATCGCTTAAACGCAGGAGG 0: 5
1: 882
2: 29355
3: 98780
4: 161337
1138670464_1138670469 0 Left 1138670464 16:58610293-58610315 CCTGTAATCCCAGCTACTCAGAG 0: 348
1: 4384
2: 66014
3: 156492
4: 239406
Right 1138670469 16:58610316-58610338 AATCGCTTAAACGCAGGAGGTGG 0: 1
1: 553
2: 18515
3: 63175
4: 101954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138670464 Original CRISPR CTCTGAGTAGCTGGGATTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr