ID: 1138670465

View in Genome Browser
Species Human (GRCh38)
Location 16:58610301-58610323
Sequence AAGCGATTCTCTGAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 3, 1: 5, 2: 13, 3: 26, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138670465_1138670471 -4 Left 1138670465 16:58610301-58610323 CCCAGCTACTCAGAGAATCGCTT 0: 3
1: 5
2: 13
3: 26
4: 116
Right 1138670471 16:58610320-58610342 GCTTAAACGCAGGAGGTGGAGGG 0: 1
1: 2
2: 158
3: 545
4: 1399
1138670465_1138670470 -5 Left 1138670465 16:58610301-58610323 CCCAGCTACTCAGAGAATCGCTT 0: 3
1: 5
2: 13
3: 26
4: 116
Right 1138670470 16:58610319-58610341 CGCTTAAACGCAGGAGGTGGAGG 0: 1
1: 214
2: 8097
3: 38252
4: 90164
1138670465_1138670469 -8 Left 1138670465 16:58610301-58610323 CCCAGCTACTCAGAGAATCGCTT 0: 3
1: 5
2: 13
3: 26
4: 116
Right 1138670469 16:58610316-58610338 AATCGCTTAAACGCAGGAGGTGG 0: 1
1: 553
2: 18515
3: 63175
4: 101954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138670465 Original CRISPR AAGCGATTCTCTGAGTAGCT GGG (reversed) Intronic
902973099 1:20069557-20069579 CAGCGATCCTCCCAGTAGCTGGG - Intronic
904917835 1:33983103-33983125 AAGGGAGTGTCTGAGAAGCTGGG - Intronic
904918625 1:33988340-33988362 AAGGGAGTGTCTGAGAAGCTGGG + Intronic
907410838 1:54282218-54282240 AAGAGCTTCTCAGAGTAGCTGGG - Intronic
909467053 1:75984174-75984196 CAGGGATTCTCTGAGTTTCTTGG + Intergenic
909642564 1:77884723-77884745 CACAGCTTCTCTGAGTAGCTGGG - Intergenic
911028378 1:93459157-93459179 AAACAATTCTTGGAGTAGCTGGG - Intronic
911257803 1:95652057-95652079 AAGAAATTCTCTGAGCACCTAGG - Intergenic
915720533 1:157981902-157981924 AAGCAATTCTCCAAGTAGCTGGG - Intergenic
916073128 1:161183414-161183436 ACCCCATTCCCTGAGTAGCTAGG + Intergenic
920015474 1:202904118-202904140 AAGCAATTTCCCGAGTAGCTGGG + Intronic
924814764 1:247431998-247432020 AAGCAATTCTTCGAGTAGTTGGG + Intronic
1067365977 10:45629176-45629198 AATCGATCCTCCGAGCAGCTGGG + Intronic
1068744660 10:60516663-60516685 AAGTGATCCTCTGGGTAACTGGG - Intronic
1069107241 10:64397826-64397848 AAGACATTCTCTCAGTAGATAGG - Intergenic
1069502672 10:68967994-68968016 AAGCAATCCTCCGAGTAGCTGGG + Intronic
1071525691 10:86356845-86356867 AAGGGATGCTCTGAGTTGTTAGG + Intronic
1073041988 10:100614182-100614204 AAGCGCTTCTCAGAGAAGATTGG + Intergenic
1073205951 10:101769448-101769470 AAGTGCTTCTCTGAGTGCCTAGG - Intergenic
1074490929 10:113938969-113938991 AAGCCAATCTCAGAATAGCTGGG - Intergenic
1079236537 11:18694866-18694888 AAGCGATTCTCCAAGTAGCTGGG + Intronic
1079343043 11:19628869-19628891 GAGCGCCTCTCAGAGTAGCTGGG - Intronic
1080580295 11:33636967-33636989 AGGAGCTTCTCTGAATAGCTTGG + Intronic
1081584031 11:44371935-44371957 AAGCTAACCTCTGAGGAGCTTGG - Intergenic
1085773176 11:79342594-79342616 AAGTGATTCTCTGTGCAGCCAGG - Intronic
1088201196 11:107337069-107337091 AAGAGATACTCTGAGCAGATGGG + Intronic
1089381289 11:118034606-118034628 AGGCGATTCTCCAAGTAGCTGGG - Intergenic
1090035919 11:123249437-123249459 AAGGGCTGCTCTGAGTAGGTGGG + Intergenic
1092883906 12:12909184-12909206 AAGGGATTCTCTGCCTAGCCAGG - Intronic
1094183021 12:27612433-27612455 AAGTGATCCTCCAAGTAGCTGGG + Intronic
1096057559 12:48667063-48667085 AAGCGATTCTCCGAGTAGCTGGG - Intronic
1096310799 12:50518854-50518876 AAGCAATCCTCCAAGTAGCTGGG + Intronic
1098107288 12:67082814-67082836 AAGAGATCCTCCGAGTAGCTAGG + Intergenic
1098135063 12:67393556-67393578 AAGCAATTTTCTGGGGAGCTGGG + Intergenic
1098448901 12:70596879-70596901 AATGGATTCTCCCAGTAGCTGGG + Intronic
1100439328 12:94601397-94601419 CAGCAATCCCCTGAGTAGCTGGG - Intronic
1101477282 12:105062811-105062833 AAGCTATTCCCTTAATAGCTTGG + Intronic
1102839839 12:116106883-116106905 AAGGGATTCCATGATTAGCTGGG + Intronic
1103954883 12:124570413-124570435 AAGGGACTCTCTAAGGAGCTGGG - Intergenic
1106526936 13:30549179-30549201 AAGCGAGCACCTGAGTAGCTGGG - Intronic
1106951694 13:34891740-34891762 ACCCCAGTCTCTGAGTAGCTAGG + Intergenic
1108355834 13:49628140-49628162 TAGAGATTCTCTGATTTGCTTGG - Intergenic
1108523744 13:51267710-51267732 AAGCGATGCTCTGAGTATAAGGG + Intronic
1109773212 13:67004453-67004475 AAGCGATTCTCTGAGTAGCTGGG - Intronic
1111426728 13:88094547-88094569 AAGCGATTTGCCCAGTAGCTGGG + Intergenic
1113502702 13:110790310-110790332 AAGCCACACTCTGAGTAACTAGG - Intergenic
1120526661 14:85584639-85584661 AAGCGATTCTCTGCTCAGCCCGG - Intronic
1124382612 15:29179444-29179466 AAGCCATTCTCTGAGTGGGATGG + Intronic
1126015353 15:44345372-44345394 ATGCCAGCCTCTGAGTAGCTGGG + Intronic
1126045906 15:44639585-44639607 ATGTGAGCCTCTGAGTAGCTGGG - Intronic
1127210008 15:56764482-56764504 AAGCAATTCCCTGAGTAGCTGGG + Intronic
1127509653 15:59627490-59627512 AAGAGATACTCTGGGTTGCTGGG - Intronic
1128826571 15:70723367-70723389 AAGAGTATCCCTGAGTAGCTGGG - Intronic
1132081277 15:98868083-98868105 AAACACTTCTCTGAGTAGCTGGG - Intronic
1133378352 16:5308223-5308245 AAGCGATCTCCTGAGTAGCTGGG - Intergenic
1135746407 16:25020510-25020532 AAGTGCTTCTCTGGGGAGCTGGG - Intergenic
1135755569 16:25094708-25094730 AAGTGCTTCTCTGGGGAGCTGGG - Intergenic
1138670465 16:58610301-58610323 AAGCGATTCTCTGAGTAGCTGGG - Intronic
1141552042 16:84812789-84812811 AAGCCATTCTCTGGGCAGCCTGG + Intergenic
1142947846 17:3448942-3448964 ATGTGTTTGTCTGAGTAGCTCGG + Exonic
1143903419 17:10191452-10191474 AAACGATCCTCCAAGTAGCTTGG - Intronic
1145215271 17:21046861-21046883 AAGCGATTTTCTGAGTAGCTGGG - Intergenic
1146328030 17:31903911-31903933 AAGCGATCCCCCGAGTAGCTGGG + Intergenic
1154963769 18:21336199-21336221 AAGCCATTCCCTGAGTAGTATGG + Intronic
1158597599 18:58829757-58829779 AAGAGATTTTCCGAGTAGCTGGG + Intergenic
1163113125 19:15173502-15173524 AAGTGATCCTCCAAGTAGCTGGG + Intronic
1163154009 19:15430233-15430255 AAGCTATTCTCTGCGTTGTTAGG - Intronic
1163221421 19:15924254-15924276 AAGCTATGCTCTGGGTACCTTGG - Intronic
1167062905 19:47161803-47161825 AAGCAATTCTATGTGTTGCTTGG - Intronic
930832548 2:55760399-55760421 AAGCAATACTCTGAGTAGCTGGG + Intergenic
931293610 2:60900001-60900023 AAGCAAATCTCTGTGGAGCTAGG + Intronic
931375212 2:61701079-61701101 CAGTGAGTCTCTGAGTAGCTGGG + Intergenic
931385294 2:61792977-61792999 AAGATAATCTCCGAGTAGCTGGG - Intergenic
931519683 2:63082131-63082153 GAGCGATCCTCTGAGTAGCTGGG + Intergenic
931890539 2:66666568-66666590 AAGTGATTTCCTGAGTAGCTGGG - Intergenic
932810634 2:74822817-74822839 AAGAGATTCTCTGAGAAGCAGGG + Intergenic
935591205 2:104846656-104846678 TAGCTATTGTCTGAGAAGCTGGG - Intergenic
937790841 2:125959625-125959647 AAGTGTTTCTCTGAGTAGCATGG - Intergenic
938237506 2:129717949-129717971 AAACTGTTCTCTGAGGAGCTTGG + Intergenic
943073086 2:183164994-183165016 AAGTGATTCTCTGAGTAGCTGGG + Intergenic
943396166 2:187338112-187338134 AAGTGATTCTCCTTGTAGCTGGG - Intergenic
944355526 2:198783106-198783128 AAGCGATTTTCTAAGTAGAAGGG - Intergenic
946651757 2:221899051-221899073 ATACGATTCTCTGAGTAGAGGGG - Intergenic
946896553 2:224330056-224330078 AAGTGATCCTCTGAGTTGCTGGG - Intergenic
947631856 2:231658713-231658735 AAGTGATCTTCTGAGTAGCTGGG - Intergenic
1173281712 20:41634140-41634162 AAGCGATCCTACAAGTAGCTGGG + Intergenic
1173582449 20:44157202-44157224 TGGCAACTCTCTGAGTAGCTGGG - Intronic
1177107555 21:16978787-16978809 AAGCCACTCTCTGAGCTGCTGGG - Intergenic
1178968873 21:37153053-37153075 AAGCAATTCTTTGAGAAGCATGG - Exonic
1180635853 22:17262508-17262530 AAGCAGTACTCTGAGTAGCTGGG - Intergenic
1181106790 22:20580370-20580392 CAGCGCTTCTCTGAGGAGCAAGG - Intronic
1183405230 22:37627248-37627270 AAGCCACACTCTGAGCAGCTGGG + Intronic
953253968 3:41271508-41271530 CAGCCTTCCTCTGAGTAGCTAGG + Intronic
954173483 3:48824291-48824313 AAGTGATTCCCCAAGTAGCTAGG - Intronic
955268612 3:57473537-57473559 AATAGATTATCTGAGTAGATAGG + Intronic
957514676 3:81234753-81234775 AATCCATTCACTGAGTAGCATGG - Intergenic
958446753 3:94225128-94225150 AATGGATGCTATGAGTAGCTGGG - Intergenic
959061281 3:101618694-101618716 AAGAGATTCTCTGAGTAGCTGGG - Intergenic
961433872 3:126902911-126902933 AAGCCATCCTTTGAGTAGCAAGG + Intronic
961740821 3:129032240-129032262 AAGCCAGTCTCTTAGGAGCTGGG - Intronic
962582420 3:136810139-136810161 AAGAGGTTCTTTGAGTAGCTGGG - Intergenic
968000926 3:195206124-195206146 ACACCATTCTCCGAGTAGCTGGG + Intronic
970366150 4:15360145-15360167 CAGCCATCCTCTGAGTAGCCAGG + Intronic
970493160 4:16596768-16596790 CAGCGATTGTGTAAGTAGCTGGG + Intronic
973623455 4:52749685-52749707 AAGTGATCCCCCGAGTAGCTGGG - Intronic
973724315 4:53758270-53758292 AAGTGAATCTCTGAGTATCTGGG - Intronic
974294101 4:59972180-59972202 AAGTGATCCTCTGAGTAGCTGGG + Intergenic
975133217 4:70848715-70848737 AAGGGATCCTCTGAGTAGCTAGG + Intergenic
978706988 4:111725612-111725634 AAGCGATCCTCCCAGTAGCTGGG + Intergenic
979495327 4:121376776-121376798 AGGAGATTCTCTGTGTAGCCAGG + Intronic
981043709 4:140246917-140246939 AAGCGATTCCCCAAGTAGCTGGG + Intergenic
981693982 4:147540964-147540986 ACGCCATTCTCCGAGTAGCTGGG - Intronic
982460560 4:155664675-155664697 AAACCATACTCTGAGTAGCAAGG + Intergenic
982887267 4:160797501-160797523 AAACGATTCCATCAGTAGCTTGG + Intergenic
984465295 4:180092885-180092907 CAGGAAGTCTCTGAGTAGCTGGG + Intergenic
985359122 4:189153733-189153755 AAGCTTTTCTGTGATTAGCTGGG - Intergenic
986395682 5:7327260-7327282 AAGCCATTCACAGAGAAGCTTGG + Intergenic
991091966 5:62702272-62702294 AGGAGATGCTCTGAGCAGCTGGG - Intergenic
992156884 5:73964201-73964223 AGTCGCTTCTCTGAGTAGCATGG - Intergenic
995517312 5:112967084-112967106 AAGGGACTTCCTGAGTAGCTGGG + Intergenic
996664697 5:126045601-126045623 AAGCTCTCCTCTGATTAGCTAGG - Intergenic
998267840 5:140679443-140679465 AGATGATTCTCTGTGTAGCTTGG + Intronic
999495837 5:152095952-152095974 AAGTGATCCTCTGAGTAGCTGGG - Intergenic
1000394492 5:160759412-160759434 AAACTATTCTCTGATTATCTGGG - Intronic
1000614455 5:163412041-163412063 AAGAGATGCTATGAGTGGCTAGG - Intergenic
1002785441 6:396497-396519 AAGGGATTCCCTGAGGAGTTTGG + Intronic
1003005758 6:2379975-2379997 AAGCGATTGCCTCAGTAGATGGG + Intergenic
1003843818 6:10151232-10151254 AAGCCATTCTCTGAGTTGCTTGG + Intronic
1003879666 6:10468497-10468519 AAGAGATTCTGGGATTAGCTTGG + Intergenic
1004062358 6:12209999-12210021 AAGCGATTCTCCGAGTAGCTGGG - Intergenic
1004746562 6:18514597-18514619 AAGCGATTCTATGAATGACTAGG - Intergenic
1007469539 6:42079662-42079684 AAGCAATTCTCAGAGTAGCTGGG + Exonic
1008979532 6:57467001-57467023 AAGCGATTCTCCTAGTAGCTGGG - Intronic
1009167662 6:60359921-60359943 AAGCGATTCTCCTAGTAGCTGGG - Intergenic
1012115474 6:95291726-95291748 AAGAGATTCTATGAGTTTCTTGG + Intergenic
1012726307 6:102815349-102815371 AAGTGATTCACTGAGTAGCATGG + Intergenic
1013346964 6:109270086-109270108 AAGCATTTTTCTGAGCAGCTTGG - Intergenic
1014709247 6:124787099-124787121 AATCCATTCTCGGAGTAGGTTGG - Intronic
1017434912 6:154406849-154406871 AAACGTTTCTCTGAGTAGCTGGG - Intronic
1022025029 7:26440496-26440518 AAGCCATTTTGTGAGTAGCTGGG + Intergenic
1023059975 7:36317359-36317381 AAGGGATTCTTTCAGTAGCAAGG + Intergenic
1023678127 7:42652035-42652057 AAGTGTTTCTCAGAGTAGGTTGG + Intergenic
1025780306 7:64595606-64595628 AAGCGACCTCCTGAGTAGCTCGG - Intergenic
1027415710 7:77972267-77972289 AAGCCATCTTCTGAGTAGCTGGG + Intergenic
1029819551 7:103132681-103132703 AAGGGATCCTCCCAGTAGCTGGG - Intronic
1031923329 7:127616863-127616885 AAGCGAGTCTCTGAGCAGCAAGG + Intergenic
1032054881 7:128676119-128676141 ACGCCATTCACCGAGTAGCTGGG + Intronic
1032295222 7:130631271-130631293 AAATGATTCTCCGAGTAACTGGG + Intronic
1032663207 7:134008742-134008764 AAGGGATCCTCCGAGGAGCTGGG + Intronic
1034392227 7:150795565-150795587 CAGGGATTCTCTCTGTAGCTTGG + Intronic
1035099414 7:156384089-156384111 AAGCGAATCTGGGAGGAGCTTGG + Intergenic
1035225818 7:157431585-157431607 AAGTGTTTGTCTGAGGAGCTGGG + Intergenic
1037223872 8:16560043-16560065 AAGAAATTCTTTGAGTATCTTGG - Intronic
1037777406 8:21844740-21844762 AGGCTCTTCTCTGAGCAGCTGGG - Intergenic
1051849723 9:21492336-21492358 AAGGGAGGCGCTGAGTAGCTTGG - Intergenic
1059292940 9:113243646-113243668 CAGTGATCCTCTGAGTAGTTGGG + Intronic
1059322863 9:113482920-113482942 AAGCGTATCTGTGAGTAGCAGGG - Intronic
1059619825 9:115991609-115991631 AAGCGATTCTTTCAGTTCCTAGG + Intergenic
1062293821 9:135812851-135812873 AAGCGATTCTCTGAGTAGCTCGG - Intronic
1187171934 X:16860570-16860592 AAGCGATTTCCCGAGTAGCTGGG - Intronic
1197897455 X:131330546-131330568 AAGGGAGTCTCTGAGGAGGTTGG + Intronic
1200838545 Y:7756379-7756401 CACCGATTCTCTCAGTTGCTAGG - Intergenic
1201243468 Y:11980372-11980394 AAGCGATCCCCTGAGTAGCTGGG + Intergenic