ID: 1138670466

View in Genome Browser
Species Human (GRCh38)
Location 16:58610302-58610324
Sequence TAAGCGATTCTCTGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 1, 2: 10, 3: 19, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138670466_1138670471 -5 Left 1138670466 16:58610302-58610324 CCAGCTACTCAGAGAATCGCTTA 0: 1
1: 1
2: 10
3: 19
4: 78
Right 1138670471 16:58610320-58610342 GCTTAAACGCAGGAGGTGGAGGG 0: 1
1: 2
2: 158
3: 545
4: 1399
1138670466_1138670469 -9 Left 1138670466 16:58610302-58610324 CCAGCTACTCAGAGAATCGCTTA 0: 1
1: 1
2: 10
3: 19
4: 78
Right 1138670469 16:58610316-58610338 AATCGCTTAAACGCAGGAGGTGG 0: 1
1: 553
2: 18515
3: 63175
4: 101954
1138670466_1138670470 -6 Left 1138670466 16:58610302-58610324 CCAGCTACTCAGAGAATCGCTTA 0: 1
1: 1
2: 10
3: 19
4: 78
Right 1138670470 16:58610319-58610341 CGCTTAAACGCAGGAGGTGGAGG 0: 1
1: 214
2: 8097
3: 38252
4: 90164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138670466 Original CRISPR TAAGCGATTCTCTGAGTAGC TGG (reversed) Intronic
902973100 1:20069558-20069580 TCAGCGATCCTCCCAGTAGCTGG - Intronic
903843221 1:26259730-26259752 TGAGCGACTCTCTGATGAGCTGG - Exonic
904917836 1:33983104-33983126 TAAGGGAGTGTCTGAGAAGCTGG - Intronic
904918624 1:33988339-33988361 TAAGGGAGTGTCTGAGAAGCTGG + Intronic
907410839 1:54282219-54282241 CAAGAGCTTCTCAGAGTAGCTGG - Intronic
911300881 1:96172232-96172254 TAAGAAAATCTCTGAGTACCAGG - Intergenic
915720534 1:157981903-157981925 CAAGCAATTCTCCAAGTAGCTGG - Intergenic
922311212 1:224392850-224392872 TAAGTGATTCTCTGTGGAGGAGG - Intronic
922767242 1:228162560-228162582 TGAGGGAGTCTCTGAGCAGCTGG - Intergenic
1069502671 10:68967993-68968015 GAAGCAATCCTCCGAGTAGCTGG + Intronic
1071874505 10:89830022-89830044 TAACCGTTACTCTGTGTAGCTGG + Intergenic
1072741221 10:97911129-97911151 TGAGGGATTCTCAGAGAAGCTGG - Intronic
1079236536 11:18694865-18694887 CAAGCGATTCTCCAAGTAGCTGG + Intronic
1083825069 11:65197133-65197155 TACGCTATTCTCTGAGTACTAGG + Intronic
1089381290 11:118034607-118034629 CAGGCGATTCTCCAAGTAGCTGG - Intergenic
1095791634 12:46174373-46174395 TAATCGATTCTTCGAGTAGTAGG - Intergenic
1096057560 12:48667064-48667086 CAAGCGATTCTCCGAGTAGCTGG - Intronic
1098565091 12:71925427-71925449 TAAGCAATTTCCTGAATAGCAGG - Exonic
1100439329 12:94601398-94601420 TCAGCAATCCCCTGAGTAGCTGG - Intronic
1105736873 13:23280880-23280902 TTATTGATTCTCTGAGTAGGAGG - Intronic
1108523743 13:51267709-51267731 TAAGCGATGCTCTGAGTATAAGG + Intronic
1109292384 13:60492373-60492395 GAAGTGATTATCTCAGTAGCTGG - Intronic
1109773213 13:67004454-67004476 CAAGCGATTCTCTGAGTAGCTGG - Intronic
1110998465 13:82144576-82144598 GAAGAGATTCTCTGAGGTGCAGG + Intergenic
1111101192 13:83589144-83589166 CAAGCGATTCTCTGACTCCCTGG - Intergenic
1117378551 14:55137665-55137687 TGAGAAATCCTCTGAGTAGCGGG + Intronic
1124838258 15:33216506-33216528 TTAGTGAGTCTGTGAGTAGCAGG - Intergenic
1127210007 15:56764481-56764503 TAAGCAATTCCCTGAGTAGCTGG + Intronic
1128826572 15:70723368-70723390 TAAGAGTATCCCTGAGTAGCTGG - Intronic
1132081278 15:98868084-98868106 CAAACACTTCTCTGAGTAGCTGG - Intronic
1133042316 16:3067150-3067172 AAAGCGCTTCTCTCAGGAGCCGG - Intronic
1133378353 16:5308224-5308246 CAAGCGATCTCCTGAGTAGCTGG - Intergenic
1138670466 16:58610302-58610324 TAAGCGATTCTCTGAGTAGCTGG - Intronic
1145215272 17:21046862-21046884 CAAGCGATTTTCTGAGTAGCTGG - Intergenic
1146202673 17:30873653-30873675 TAAGATACTCTGTGAGTAGCTGG - Intronic
1146328029 17:31903910-31903932 CAAGCGATCCCCCGAGTAGCTGG + Intergenic
1147202039 17:38809009-38809031 TAAGCAATCTTCTGAGTAGCTGG - Intronic
1153263741 18:3247826-3247848 TTAGCGGCTCTCTGGGTAGCAGG + Exonic
1157680521 18:49602055-49602077 TAAGGGATTCTCTGATGGGCGGG - Intergenic
1157889250 18:51399223-51399245 TAAGCTTTCCTCTGAGAAGCAGG + Intergenic
1158597598 18:58829756-58829778 CAAGAGATTTTCCGAGTAGCTGG + Intergenic
1168096064 19:54115558-54115580 ACAGCGATTCTCTGCTTAGCAGG + Exonic
926984824 2:18611321-18611343 TCAGCATTTCACTGAGTAGCAGG - Intergenic
930832547 2:55760398-55760420 CAAGCAATACTCTGAGTAGCTGG + Intergenic
930881987 2:56280653-56280675 CAAGTGATTCTCTCAGTAGCTGG - Intronic
931375211 2:61701078-61701100 TCAGTGAGTCTCTGAGTAGCTGG + Intergenic
931385295 2:61792978-61793000 TAAGATAATCTCCGAGTAGCTGG - Intergenic
931519682 2:63082130-63082152 CGAGCGATCCTCTGAGTAGCTGG + Intergenic
931575691 2:63716118-63716140 TAAGCGTTTCTCTGAGAAGCTGG + Intronic
931890540 2:66666569-66666591 GAAGTGATTTCCTGAGTAGCTGG - Intergenic
932810633 2:74822816-74822838 CAAGAGATTCTCTGAGAAGCAGG + Intergenic
935591206 2:104846657-104846679 TTAGCTATTGTCTGAGAAGCTGG - Intergenic
939891224 2:147738598-147738620 TAAGCGATTTGCTGTGTACCAGG + Intergenic
942927067 2:181446600-181446622 AAAGTGATTCTCTGAGTAGTTGG - Intergenic
943073085 2:183164993-183165015 CAAGTGATTCTCTGAGTAGCTGG + Intergenic
944355527 2:198783107-198783129 AAAGCGATTTTCTAAGTAGAAGG - Intergenic
946651758 2:221899052-221899074 AATACGATTCTCTGAGTAGAGGG - Intergenic
946896554 2:224330057-224330079 CAAGTGATCCTCTGAGTTGCTGG - Intergenic
947631857 2:231658714-231658736 CAAGTGATCTTCTGAGTAGCTGG - Intergenic
1175439983 20:58983538-58983560 CAAGTGATTCTCCAAGTAGCTGG + Intronic
1176364992 21:6027373-6027395 TAAGAGTTTGACTGAGTAGCGGG + Intergenic
1179758526 21:43511172-43511194 TAAGAGTTTGACTGAGTAGCGGG - Intergenic
1180635854 22:17262509-17262531 CAAGCAGTACTCTGAGTAGCTGG - Intergenic
1180909674 22:19440604-19440626 TATGCGATTCTCTGGGTGGCAGG - Intronic
1184495849 22:44840938-44840960 TAAGCGCCTCACTGAGTACCTGG + Intronic
1184971827 22:48027948-48027970 TAGGTTCTTCTCTGAGTAGCTGG - Intergenic
955571869 3:60315872-60315894 TGAGCAATTCTTTGAGTAGTTGG - Intronic
957965589 3:87319301-87319323 TAATAGATTCACTGAGTAGTAGG + Intergenic
959061282 3:101618695-101618717 CAAGAGATTCTCTGAGTAGCTGG - Intergenic
962582421 3:136810140-136810162 CAAGAGGTTCTTTGAGTAGCTGG - Intergenic
962938732 3:140106177-140106199 TAACAGATTCCCTGAGTAACAGG + Intronic
967688452 3:192444849-192444871 TTAGGGATTCTCTGAGTAGCAGG + Intronic
970493159 4:16596767-16596789 TCAGCGATTGTGTAAGTAGCTGG + Intronic
971008890 4:22407886-22407908 TAAGCAATTGTCTAAGTACCAGG + Intronic
972707104 4:41555854-41555876 TAATCTGTTTTCTGAGTAGCTGG + Intronic
973724316 4:53758271-53758293 CAAGTGAATCTCTGAGTATCTGG - Intronic
974294100 4:59972179-59972201 CAAGTGATCCTCTGAGTAGCTGG + Intergenic
978036497 4:104001821-104001843 TCAGCTATTCTCAGAGTAGTTGG + Intergenic
978706987 4:111725611-111725633 CAAGCGATCCTCCCAGTAGCTGG + Intergenic
980094199 4:128472722-128472744 TAAGAGTTTATCTGAGTAGGGGG + Intergenic
981043708 4:140246916-140246938 CAAGCGATTCCCCAAGTAGCTGG + Intergenic
981693983 4:147540965-147540987 CACGCCATTCTCCGAGTAGCTGG - Intronic
984465294 4:180092884-180092906 TCAGGAAGTCTCTGAGTAGCTGG + Intergenic
996433971 5:123413859-123413881 TCATCAATTCTCTGAGTAGCTGG - Intronic
998265387 5:140664196-140664218 CAAGCGATCCTCCGAGTAGCTGG - Intergenic
999495838 5:152095953-152095975 CAAGTGATCCTCTGAGTAGCTGG - Intergenic
1004062359 6:12210000-12210022 CAAGCGATTCTCCGAGTAGCTGG - Intergenic
1004530834 6:16454027-16454049 CAAGCGATTGTCTGAGTAGCTGG - Intronic
1007411233 6:41663070-41663092 GAAGCCCTTCTCTGGGTAGCAGG - Intergenic
1007469538 6:42079661-42079683 CAAGCAATTCTCAGAGTAGCTGG + Exonic
1008979533 6:57467002-57467024 CAAGCGATTCTCCTAGTAGCTGG - Intronic
1009167663 6:60359922-60359944 CAAGCGATTCTCCTAGTAGCTGG - Intergenic
1013703377 6:112800967-112800989 TAAGCTATTGTCTGAGTACATGG - Intergenic
1017434913 6:154406850-154406872 CAAACGTTTCTCTGAGTAGCTGG - Intronic
1022025028 7:26440495-26440517 CAAGCCATTTTGTGAGTAGCTGG + Intergenic
1024127719 7:46317717-46317739 TAAGTGATTCTCTCTGTGGCTGG + Intergenic
1027415709 7:77972266-77972288 CAAGCCATCTTCTGAGTAGCTGG + Intergenic
1031705140 7:124971393-124971415 CAAGCGATCCTCCAAGTAGCTGG - Intergenic
1037070138 8:14635576-14635598 TGAGTGCTGCTCTGAGTAGCAGG + Intronic
1038900874 8:31842267-31842289 TAAGCAAATATATGAGTAGCTGG - Intronic
1039906614 8:41791055-41791077 TAATAGGTTTTCTGAGTAGCTGG + Intronic
1052026213 9:23576350-23576372 CAAGCAATTCCCTGATTAGCTGG + Intergenic
1059322864 9:113482921-113482943 AAAGCGTATCTGTGAGTAGCAGG - Intronic
1186241806 X:7576235-7576257 GAACCAATTGTCTGAGTAGCTGG - Intergenic
1186908597 X:14137627-14137649 TAAGCCATTCTCTGAGTAACAGG + Intergenic
1187171935 X:16860571-16860593 CAAGCGATTTCCCGAGTAGCTGG - Intronic
1193903876 X:87219109-87219131 TCAGAAATTTTCTGAGTAGCAGG + Intergenic
1193974374 X:88099335-88099357 TCAGGGATTCTCTGAGGGGCGGG + Intergenic
1201243467 Y:11980371-11980393 GAAGCGATCCCCTGAGTAGCTGG + Intergenic