ID: 1138670471

View in Genome Browser
Species Human (GRCh38)
Location 16:58610320-58610342
Sequence GCTTAAACGCAGGAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2105
Summary {0: 1, 1: 2, 2: 158, 3: 545, 4: 1399}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138670466_1138670471 -5 Left 1138670466 16:58610302-58610324 CCAGCTACTCAGAGAATCGCTTA 0: 1
1: 1
2: 10
3: 19
4: 78
Right 1138670471 16:58610320-58610342 GCTTAAACGCAGGAGGTGGAGGG 0: 1
1: 2
2: 158
3: 545
4: 1399
1138670464_1138670471 4 Left 1138670464 16:58610293-58610315 CCTGTAATCCCAGCTACTCAGAG 0: 348
1: 4384
2: 66014
3: 156492
4: 239406
Right 1138670471 16:58610320-58610342 GCTTAAACGCAGGAGGTGGAGGG 0: 1
1: 2
2: 158
3: 545
4: 1399
1138670463_1138670471 23 Left 1138670463 16:58610274-58610296 CCAGGCATGGTGGTAGACACCTG 0: 15
1: 832
2: 12470
3: 48626
4: 117736
Right 1138670471 16:58610320-58610342 GCTTAAACGCAGGAGGTGGAGGG 0: 1
1: 2
2: 158
3: 545
4: 1399
1138670465_1138670471 -4 Left 1138670465 16:58610301-58610323 CCCAGCTACTCAGAGAATCGCTT 0: 3
1: 5
2: 13
3: 26
4: 116
Right 1138670471 16:58610320-58610342 GCTTAAACGCAGGAGGTGGAGGG 0: 1
1: 2
2: 158
3: 545
4: 1399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138670471 Original CRISPR GCTTAAACGCAGGAGGTGGA GGG Intronic
Too many off-targets to display for this crispr