ID: 1138671696

View in Genome Browser
Species Human (GRCh38)
Location 16:58620736-58620758
Sequence CAGTAGTACCACAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138671692_1138671696 12 Left 1138671692 16:58620701-58620723 CCACTGCTTAACAGTCTTTTGAC 0: 1
1: 0
2: 0
3: 17
4: 144
Right 1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG 0: 1
1: 1
2: 0
3: 17
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138671696 Original CRISPR CAGTAGTACCACAGGGAAGG AGG Intronic
900397617 1:2459609-2459631 AAGGAGGACCACAGGCAAGGAGG - Intronic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905732529 1:40306504-40306526 CAGTACCCCCACAGGGAGGGAGG + Intronic
908094809 1:60726444-60726466 AATTAGTACCACAGAGAAGATGG + Intergenic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
908292503 1:62682500-62682522 CAGTATAAAAACAGGGAAGGGGG + Intronic
911822566 1:102439550-102439572 CAGTAGTAGCACAGAATAGGTGG + Intergenic
915494015 1:156268222-156268244 CAGTAGGACCATAGGGACTGCGG - Intronic
916415928 1:164591962-164591984 CAAAAGTGCCACAGGGGAGGTGG - Intronic
916468374 1:165094933-165094955 CAGCAGCACCACAGCGTAGGAGG + Intergenic
917556134 1:176090556-176090578 CAGCAGCAGCACAGGGCAGGGGG + Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918409724 1:184245816-184245838 GGGGAGTACCATAGGGAAGGTGG - Intergenic
919687050 1:200493514-200493536 CAGAAATTCCACAGGAAAGGAGG + Intergenic
921079444 1:211726780-211726802 CATTAGGACCACATGGAATGAGG + Intergenic
923790577 1:237107859-237107881 CAGGGGAACCCCAGGGAAGGAGG - Intronic
924069809 1:240264864-240264886 CAATAATATCAGAGGGAAGGAGG - Intronic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1065963866 10:30755048-30755070 CAGGAGGAGCACAGGGATGGAGG - Intergenic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1070584860 10:77756490-77756512 CAGTAGCACCACACTGTAGGAGG + Intergenic
1072692669 10:97582249-97582271 CTGTGGTACCCCTGGGAAGGCGG - Intronic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1076121512 10:127940376-127940398 CTGCAGTACCTCAGGGATGGTGG - Intronic
1076562055 10:131373473-131373495 CAGAAGTTCCACAGGGACGGGGG - Intergenic
1076823411 10:132953682-132953704 CAGTAGTTCCAAAAGGGAGGAGG + Intergenic
1079006971 11:16798327-16798349 GAGCAGTGCCACAGGCAAGGTGG + Intronic
1079112168 11:17611009-17611031 AAAGAGCACCACAGGGAAGGTGG + Exonic
1079786538 11:24680276-24680298 CAGAAGCAGCACAGGGAAGCTGG - Intronic
1080502371 11:32882925-32882947 GAGAAGTACCTAAGGGAAGGGGG + Intergenic
1081584797 11:44376894-44376916 CAGCAGAATCCCAGGGAAGGGGG - Intergenic
1083560730 11:63671224-63671246 CAGAACTACAGCAGGGAAGGCGG + Intronic
1083776371 11:64896075-64896097 CAGAAGGACCCCAGGGAAGCTGG - Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1089612510 11:119677383-119677405 CAGGAGGGCGACAGGGAAGGAGG + Intronic
1090505523 11:127308985-127309007 CAGTAATACACCAGGGAATGAGG + Intergenic
1096918297 12:55057216-55057238 CAGTAGTCCCAGAGTAAAGGTGG - Intergenic
1101248577 12:102909518-102909540 AAAAAGTACCACATGGAAGGGGG - Intronic
1102668660 12:114598763-114598785 CAGTAGAAGCACAGGGAATTGGG + Intergenic
1103362766 12:120363401-120363423 AAGGACTAACACAGGGAAGGGGG + Intronic
1103890729 12:124237247-124237269 CAGTAGCCCCACAGGGCTGGTGG - Intronic
1104106769 12:125668253-125668275 CAATAATACCACAGGAAAAGGGG - Intergenic
1104781822 12:131426498-131426520 CAGTAGTTCCAGAAGGGAGGAGG - Intergenic
1105972763 13:25445902-25445924 AAGTAGTAGCGCTGGGAAGGAGG - Intronic
1106338390 13:28805557-28805579 CAGTTGTAGAACATGGAAGGAGG - Intergenic
1106938495 13:34750330-34750352 CTGCAGGACCACAGGGAGGGAGG + Intergenic
1108271223 13:48761392-48761414 CAGAAGCACCAAAGGGAATGGGG - Intergenic
1111460643 13:88537030-88537052 CAGTTTTTCCACAGAGAAGGCGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1115619423 14:35126518-35126540 GAGGAGAACCACAGGGAAGAAGG + Intronic
1115663464 14:35520968-35520990 CAGGAATACCAAAGGGAAGTAGG + Intergenic
1120503473 14:85325374-85325396 CAGTAGTATAACAAGGTAGGTGG - Intergenic
1121277667 14:92678903-92678925 CAGAAGAACCACAGGCACGGTGG + Intronic
1121695186 14:95906655-95906677 TAGTATTACCACACTGAAGGGGG - Intergenic
1124061227 15:26295235-26295257 CTGCAGTACACCAGGGAAGGAGG + Intergenic
1124182632 15:27491118-27491140 CAGTAGCACAGCAAGGAAGGAGG - Intronic
1125526412 15:40378354-40378376 AAGAAGTACCAAGGGGAAGGAGG + Intergenic
1126987634 15:54331092-54331114 CAGTAGTTTCACAGAGGAGGTGG - Intronic
1127281557 15:57497653-57497675 CAGCAGTTCCACAGGAATGGAGG + Intronic
1129445764 15:75616758-75616780 CTGTGGTACCATAGGGAAAGAGG - Intronic
1130005133 15:80088851-80088873 CCGTAGTTCCACAGGGCTGGTGG + Intronic
1131279270 15:91007613-91007635 CAGTAGGACCACCTGGAAAGTGG + Intronic
1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG + Intronic
1133481918 16:6179083-6179105 CTGTCTTACCACAGGGAGGGTGG + Intronic
1134006606 16:10822339-10822361 CAGAACAACCCCAGGGAAGGAGG + Intergenic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1137480932 16:48851497-48851519 CAATATCACCCCAGGGAAGGGGG + Intergenic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1139047174 16:63076053-63076075 CAGCAGCACCACAGTGTAGGAGG - Intergenic
1139120458 16:64009852-64009874 CAAGAGTACCATAGGGCAGGTGG - Intergenic
1140112881 16:72018594-72018616 CAGGAGGGCCACAGGGAGGGAGG - Intronic
1140882414 16:79210912-79210934 CAATGGGACCACAGGTAAGGGGG - Intronic
1141923288 16:87150710-87150732 CAATCTTACCACAGGGATGGGGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1143091865 17:4453647-4453669 CAGGAGTTCCACAGTGAAGAAGG + Intronic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1147966922 17:44199030-44199052 CAGCAGTGCCGCAGGGACGGGGG - Intronic
1150522406 17:65882884-65882906 GAGTAGGGTCACAGGGAAGGAGG - Intronic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1152416984 17:80169105-80169127 CAGTATTCCCACAGAGAAGATGG + Intergenic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1155025299 18:21935340-21935362 CTGCAGTCCCACATGGAAGGGGG - Intergenic
1158778287 18:60614477-60614499 CAGTTTTTCCACAGGGCAGGGGG - Intergenic
1160663866 19:313778-313800 CAGGAGGAGCACAGGGATGGCGG - Intronic
1160878741 19:1310088-1310110 CAATGGGATCACAGGGAAGGCGG - Intergenic
1161037041 19:2090602-2090624 CATAAGTCCCACAGGGAAGGAGG - Intronic
1161584472 19:5097729-5097751 CAGAAGAACAAAAGGGAAGGTGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1166350403 19:42195261-42195283 CAAGAGTAACACAGGAAAGGAGG + Intronic
925395470 2:3530227-3530249 TAGTAGTACTACGGGGAAGAAGG + Intergenic
927181467 2:20449275-20449297 TAGAAGTACCACTGGGAGGGAGG - Exonic
932696795 2:73963869-73963891 CAGTAGTCACACAAGGAAAGGGG + Intergenic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
934866582 2:97819461-97819483 CATTAGTAAAACAGAGAAGGAGG - Intronic
935831626 2:107006615-107006637 CACTAGAGCCACAGGGAAAGAGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
939560456 2:143725585-143725607 TTGTGGAACCACAGGGAAGGAGG - Intronic
941723218 2:168834415-168834437 CAGGAATCCCACAGAGAAGGAGG - Intronic
942189706 2:173457596-173457618 CAGGAGTCCCACGGGGAAGACGG - Intergenic
944271815 2:197792560-197792582 CAGTAGTACCCCAGGGATATGGG + Intergenic
944476319 2:200110417-200110439 GAGTAGTACCAGAGGGAGGTAGG - Intergenic
945072557 2:206005946-206005968 CAGGAGTAGAACAGGCAAGGTGG - Intronic
947556590 2:231098868-231098890 AAGAGGTACCACAAGGAAGGGGG - Intronic
949040980 2:241849919-241849941 TAATAGAACCACAGGGAAGGGGG + Exonic
1169032233 20:2418375-2418397 CACTAGTACCACACACAAGGTGG - Intronic
1172205239 20:33158752-33158774 CATTAGTACCACAGGGATTGGGG - Intergenic
1172286179 20:33742072-33742094 CAGTAGAGCCACAGGAAAGAAGG - Intronic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173602630 20:44306980-44307002 CAGCAGTGCCACCAGGAAGGGGG - Exonic
1174118078 20:48241639-48241661 CAGGAGGACAACAGGGCAGGAGG - Intergenic
1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG + Intergenic
1174384868 20:50181471-50181493 CAGTAGTAGCCCAGGGCCGGGGG - Intergenic
1176231303 20:64034400-64034422 CCCCAGAACCACAGGGAAGGGGG - Intronic
1177244815 21:18509752-18509774 AACTGGTACCACAGGGAATGGGG + Intergenic
1178418762 21:32426465-32426487 GAGCAGGAACACAGGGAAGGAGG - Intronic
1178436900 21:32567696-32567718 CCCCAGTCCCACAGGGAAGGTGG + Intergenic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1180076901 21:45467676-45467698 CAGTTCCACCACAGGGAAGGAGG - Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1181441221 22:22936030-22936052 CAGCAGGACCCCAGGGAGGGGGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183264010 22:36814681-36814703 CACTAGTACCAGAGGGCTGGGGG + Intronic
1184097298 22:42323422-42323444 CATTAGCATCACAGGGAAGGGGG + Intronic
950301774 3:11885781-11885803 CAGTAGTTCCACAGTGAAGAAGG - Intergenic
950955083 3:17044292-17044314 AAGTAGAAACACAGGGAATGGGG - Intronic
951745676 3:25974656-25974678 CAGTGGGACAACTGGGAAGGGGG + Intergenic
951978160 3:28537552-28537574 AAGAAGTGACACAGGGAAGGTGG + Intronic
955036344 3:55271805-55271827 CAATAGCACAACAGGGAAGGAGG + Intergenic
955185094 3:56707820-56707842 CAACACTACCACAGAGAAGGGGG + Intergenic
956738216 3:72255452-72255474 CAGGAGCCCCACAAGGAAGGGGG + Intergenic
958187706 3:90144489-90144511 CAGGAAAACCACAGGAAAGGGGG + Intergenic
967118116 3:186360420-186360442 CAGGAGTACGACCGGGAAGTTGG + Intronic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
969666108 4:8558373-8558395 CAGTTGTGCCCCAAGGAAGGGGG + Intergenic
969686307 4:8676285-8676307 CTGTTGTTCCACAGAGAAGGAGG - Intergenic
981195904 4:141920110-141920132 CAGTGGGACCACAGGGAGTGGGG - Intergenic
981415860 4:144492656-144492678 CAGGAGTACAAAAGGGAAAGGGG + Intergenic
981835708 4:149050968-149050990 GAGCAGGACCTCAGGGAAGGAGG - Intergenic
982761543 4:159290146-159290168 CAGTGGCACCACAGTGAAGTGGG + Intronic
983267409 4:165522186-165522208 CAGGAGTAAGACAGAGAAGGGGG - Intergenic
984640271 4:182157339-182157361 AAGTTATTCCACAGGGAAGGAGG - Intronic
988499057 5:31768869-31768891 CAGTATTACCACAGCGAAGTTGG - Intronic
991539970 5:67716715-67716737 CAATTGTAGCACAGGGAAGTAGG + Intergenic
993372099 5:87105520-87105542 AAGTGGAACCACAGTGAAGGTGG + Intergenic
993882671 5:93381271-93381293 CAGGAGTGACACAGGCAAGGAGG + Intergenic
995829147 5:116334455-116334477 CAGTGGGCCCACAGGGATGGGGG - Intronic
996994706 5:129681275-129681297 CAGCAGTATCACGTGGAAGGTGG - Intronic
997251945 5:132395912-132395934 CAGGAGGAGAACAGGGAAGGAGG + Intergenic
999367287 5:151031394-151031416 CAGAAGTCCCACAGGCGAGGTGG + Intronic
1000327502 5:160183559-160183581 AAGCAGCACCACAGGGAAGGGGG + Intergenic
1004519599 6:16349172-16349194 AAATAGGACCACAGTGAAGGAGG - Intronic
1004846851 6:19653033-19653055 AAGTAGTTCCTCATGGAAGGAGG - Intergenic
1007509493 6:42364338-42364360 GAGAAATACAACAGGGAAGGAGG - Intronic
1007598533 6:43066918-43066940 CAGTCCTTCCAAAGGGAAGGAGG + Intronic
1010809964 6:80289922-80289944 CTCTAGTCCCACAGGGAAGCTGG - Intronic
1010881014 6:81171769-81171791 CAGGAGTACCAAAGGTAAAGAGG + Intergenic
1011963671 6:93124439-93124461 CTTTTGTGCCACAGGGAAGGAGG - Intergenic
1017352589 6:153459411-153459433 CCTCAGTCCCACAGGGAAGGTGG + Intergenic
1017967254 6:159277129-159277151 GAGTAGTACCATAGGCAAGTGGG + Intergenic
1018144906 6:160877032-160877054 CCCCAGTCCCACAGGGAAGGTGG - Intergenic
1018379306 6:163243288-163243310 CAGAAGTTCCACGGGGAAAGGGG + Intronic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1022537288 7:31106163-31106185 AAGCAGTCCCACAGGGCAGGTGG - Intronic
1024381253 7:48698805-48698827 CAGGAATACCCCAGGCAAGGGGG + Intergenic
1024614557 7:51100032-51100054 CAGGATTACCACAGTGGAGGTGG - Intronic
1027254891 7:76424994-76425016 CAGTACTACCCCAGAGCAGGAGG - Exonic
1028267817 7:88749458-88749480 CAGTAGTACCCCGGGGAAGAGGG + Intergenic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1037993504 8:23337217-23337239 TAGTACTACCAAAGGCAAGGTGG - Intronic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1038423017 8:27445680-27445702 CATGAGCACCACAGGGAATGGGG - Intronic
1038589905 8:28827386-28827408 CAGAAGGACCACTTGGAAGGTGG + Intronic
1044793521 8:95872499-95872521 CAGTATTGGCACAGGGCAGGGGG - Intergenic
1048427374 8:134335346-134335368 CAGTAACAGCATAGGGAAGGGGG + Intergenic
1051044373 9:12855790-12855812 AAGTATTACTACAGGGAAGCAGG + Intergenic
1055203867 9:73702304-73702326 CAATAATAGCACAAGGAAGGAGG + Intergenic
1055359230 9:75471567-75471589 CAGAAATAACACAGGGGAGGAGG + Intergenic
1056342722 9:85653529-85653551 CAGTAGTAACACCAGGAAGGAGG - Intronic
1057326087 9:94065452-94065474 CAGTAGGACTAAAGTGAAGGTGG - Intronic
1057700453 9:97360175-97360197 CAGTAGAGCCAAAGGGAAGAGGG + Intronic
1060740041 9:126091989-126092011 CAGTAGTCTCAAAGGCAAGGAGG + Intergenic
1186643532 X:11482518-11482540 CAGTATGAGCACAAGGAAGGTGG - Intronic
1189136382 X:38555026-38555048 CAGTGGTGCCTCTGGGAAGGAGG - Intronic
1189748304 X:44193013-44193035 CAGTAATTCCACAAGGGAGGAGG - Intronic
1194341621 X:92712847-92712869 CAGTAGTTCCAAAAGGGAGGAGG - Intergenic
1197355901 X:125437252-125437274 CAGTCATACTACAGGGAAAGGGG + Intergenic
1198320471 X:135514594-135514616 GAGGAATAACACAGGGAAGGAGG - Intergenic
1198586619 X:138128860-138128882 CCCCAGTACCACAGGGAAGACGG + Intergenic
1200649970 Y:5829545-5829567 CAGTAGTTCCAAAAGGGAGGAGG - Intergenic
1201060298 Y:10038360-10038382 CAGTACTTCCAGAGGGAGGGAGG + Intergenic
1201565526 Y:15361500-15361522 CATTAGTGTCACAGGCAAGGGGG - Intergenic