ID: 1138672698

View in Genome Browser
Species Human (GRCh38)
Location 16:58628843-58628865
Sequence TAGTATCTGTGAGCCCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138672698 Original CRISPR TAGTATCTGTGAGCCCTCTT GGG Intronic
902533763 1:17107112-17107134 AAGTCCCTCTGAGCCCTCTTGGG - Intronic
905541438 1:38763479-38763501 TAGTCTTTGTGAGACCTCTGAGG + Intergenic
914999188 1:152572708-152572730 CAGTTTCTGTGAGCTATCTTGGG + Intronic
915778668 1:158521068-158521090 TAGTATATGTGACTCCTCCTGGG - Intergenic
916282257 1:163064651-163064673 TAGTTTCTATGACCCATCTTGGG + Intergenic
921476428 1:215616087-215616109 TGGTTTCTGTGAGCCACCTTGGG + Intronic
923958255 1:239047044-239047066 TAGTTTCTATGACCTCTCTTGGG + Intergenic
1070721073 10:78757666-78757688 CAGCATCTGCGAGCCCTCCTGGG - Intergenic
1071038230 10:81274031-81274053 TATTATCAGTGGGCCTTCTTTGG + Intergenic
1077995207 11:7446811-7446833 TTCTGTCTGTGAGCCCACTTTGG + Intronic
1078205949 11:9229517-9229539 TATTATCTGTGACCCGCCTTGGG - Intronic
1081927137 11:46840245-46840267 TAGTTTCTGTAATCCCTCTGGGG - Intronic
1083048549 11:59756847-59756869 TAATAACTGTGAGTGCTCTTGGG + Intronic
1083515147 11:63250565-63250587 TAGTATCTCTTAGCACTTTTTGG + Intronic
1089843594 11:121440564-121440586 TAGTTTCTGTGACCCACCTTGGG - Intergenic
1091692078 12:2604198-2604220 TGGTTTCTGTGACCCATCTTGGG + Intronic
1092693748 12:11144982-11145004 GAGGATCTGTGGGTCCTCTTGGG + Intronic
1094575091 12:31677780-31677802 TAGTTTCTGTGACCCACCTTGGG - Intronic
1098380590 12:69865486-69865508 TAGTATCTATGAACCATCTTGGG + Intronic
1099806015 12:87519385-87519407 TAGTAGCAGTGAGCTCTCTTAGG - Intergenic
1100358944 12:93858676-93858698 TAGTTTCTATGACCCATCTTGGG - Intronic
1103240742 12:119411379-119411401 TAGTTTCTGTGAGCCAGCTTGGG + Intronic
1106730407 13:32536086-32536108 TTGTATCTGAGAGTCATCTTGGG + Intronic
1110794279 13:79619152-79619174 TGGTTTCTGTGGGACCTCTTGGG + Intergenic
1113996778 14:16090592-16090614 TAATATTTGTGAGCCCTTTGAGG - Intergenic
1118163866 14:63317098-63317120 AAGTCTCTGGGAGCCCTCTGGGG - Intronic
1119631686 14:76237565-76237587 CAGCATCAGTGAGCCCCCTTGGG + Intronic
1122290442 14:100677968-100677990 TGGCATCTGTGAGCCCCTTTCGG + Intergenic
1122821433 14:104347452-104347474 TATTATATGGGAGCCCTGTTGGG - Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1128578290 15:68790995-68791017 TAGTTTCTGTGACCCGCCTTGGG - Intronic
1130149380 15:81299741-81299763 CAGGATCAGGGAGCCCTCTTGGG - Exonic
1130619000 15:85441646-85441668 TTGTATCTGTGATCCATATTTGG + Intronic
1138672698 16:58628843-58628865 TAGTATCTGTGAGCCCTCTTGGG + Intronic
1138993507 16:62420450-62420472 TAGTTTCAGTGAACTCTCTTTGG - Intergenic
1139816828 16:69681585-69681607 TAGATTTTGTGAGCACTCTTAGG - Intronic
1142781173 17:2182377-2182399 TCCTATCTGTGGGCCCTCCTAGG - Intronic
1144031109 17:11324319-11324341 AATTATCTGTGAGCTGTCTTTGG + Intronic
1145416988 17:22724081-22724103 TGGTATTTGTGAGCCCTTTGAGG + Intergenic
1146518366 17:33507271-33507293 TAGAGTCTGTGGGCCCTCTCTGG - Intronic
1146749991 17:35369501-35369523 TAGCATCTGTGAACCCACCTAGG + Intronic
1149756701 17:59192227-59192249 TAGTAGCTGTCAGCACTCCTTGG - Intronic
1150280763 17:63928643-63928665 TGGCATCTGTGAGCCCTCGAGGG - Intergenic
1156645715 18:39159868-39159890 TACTATCTGGGAGCCCTGATGGG + Intergenic
1157968029 18:52231110-52231132 TAGTATCTCTGGCACCTCTTGGG - Intergenic
1158829623 18:61263423-61263445 GAGGGTCTGTGGGCCCTCTTGGG - Intergenic
1160429450 18:78801398-78801420 TAGCATCTGTGAGACCTCAGTGG - Intergenic
1165806712 19:38584802-38584824 CCGTATCTGTGAGCCCTTTGAGG + Intronic
1167603337 19:50467059-50467081 TGGAATCTGTGCCCCCTCTTAGG - Intronic
1167869929 19:52359862-52359884 TGGTTTCTGTGGCCCCTCTTTGG + Intronic
932100857 2:68897669-68897691 GAGGGTCTGTGAGTCCTCTTGGG + Intergenic
938942144 2:136178698-136178720 TAGTTTCTATGAGCCACCTTAGG + Intergenic
940762208 2:157750473-157750495 TGGTGTCTGTGAGTCCTTTTTGG - Intronic
944906969 2:204271677-204271699 TATTATCTGTGACTCTTCTTAGG + Intergenic
946275256 2:218626927-218626949 TAGTAACTGTGAGCTCCATTTGG + Intronic
946425917 2:219596622-219596644 TAGTTTCTGTGACTCATCTTGGG + Intergenic
1169336337 20:4760185-4760207 GAGGATCTGTGCGTCCTCTTGGG + Intergenic
1173727175 20:45306373-45306395 TAGTTTCTGTGAGCCAGCCTGGG + Intronic
1178801545 21:35800668-35800690 GAGGGTCTGTGGGCCCTCTTGGG - Intronic
1178934941 21:36853147-36853169 TTGTACCTGTGTGCCCTCTTGGG - Intronic
1180310145 22:11216684-11216706 TAATATTTGTGAGCCCTTTGAGG + Intergenic
951982538 3:28581526-28581548 TTGTATCTGTTAGGACTCTTTGG + Intergenic
952746186 3:36783281-36783303 TAGTATCTATGAGCCCTTCTTGG + Intergenic
953777271 3:45831307-45831329 CAGTATCTGTGAGTCAGCTTTGG + Intronic
954898896 3:54001971-54001993 TATAGTCTGTGAGCCCTTTTAGG + Intergenic
955905599 3:63804347-63804369 CAGTGTCTGTGAGCCATGTTAGG - Intergenic
955925298 3:63998428-63998450 ATGTATCTGTGGGCCATCTTTGG + Intronic
956344476 3:68262821-68262843 TAGTAGCTGTGAACACTTTTGGG + Intronic
958202904 3:90344006-90344028 TGGTATTTGTGAGCCCTTTGAGG - Intergenic
959515994 3:107267812-107267834 TATTAAGTGTAAGCCCTCTTTGG - Intergenic
961474844 3:127140207-127140229 TGGCATCTGTGAGCCCTGCTTGG + Intergenic
965875195 3:173308827-173308849 TAGTAAATGTGAGCCATTTTTGG + Intergenic
969985785 4:11209217-11209239 TTGGATCTGTCAGACCTCTTGGG + Intergenic
972154851 4:36147136-36147158 TAGTATATATTAGCTCTCTTTGG - Intronic
972161459 4:36233146-36233168 TTGGATCTGTGAACACTCTTGGG - Intronic
972416167 4:38842610-38842632 AAGCATCTGTGAGCCCCCATGGG + Intronic
972581390 4:40398555-40398577 TAGCATCTCTGGGCCTTCTTGGG + Intergenic
973337265 4:48969349-48969371 CATTAACTGTGAGCCCTCTGTGG - Intergenic
974057877 4:57002603-57002625 TACTATCTGTGACCTCACTTTGG + Intronic
977384177 4:96317523-96317545 TAGTATATGTTTTCCCTCTTGGG + Intergenic
979478198 4:121183362-121183384 GAGTATCTGGAAGCCCCCTTAGG + Intronic
981018564 4:140001425-140001447 TATTAACTCTGAGACCTCTTGGG - Intronic
981346496 4:143683274-143683296 GAGGGTCTGTGAGTCCTCTTGGG - Intronic
984367053 4:178812944-178812966 CAGAATCTGTGACACCTCTTTGG - Intergenic
989030738 5:37115911-37115933 TAGTAACTGAGAGGCATCTTAGG - Intronic
990277594 5:54214825-54214847 TAGTAGCTGTGACCCCACATTGG + Intronic
991312295 5:65257462-65257484 TATTCCCTGTTAGCCCTCTTTGG + Intronic
992930976 5:81644797-81644819 CAGTATCTGTGAGCCTTTATTGG - Intronic
993339035 5:86699134-86699156 TAGTAACTGAGGCCCCTCTTGGG + Intergenic
993567063 5:89489279-89489301 TAGTAACAGTTGGCCCTCTTGGG + Intergenic
996266479 5:121547150-121547172 CATTATCTGTGAGTCCTCTGAGG - Intergenic
1003592382 6:7446858-7446880 CAGTATCTGTGTGGCCTGTTAGG - Intergenic
1008085106 6:47236105-47236127 CAGTAGCTGTGTGCCCTCTTTGG - Intronic
1008960253 6:57259250-57259272 TAGTATCTTTGAGTCATCTTGGG + Intergenic
1012824055 6:104125624-104125646 TGATATCTCTGAGCCCACTTGGG - Intergenic
1013877735 6:114855216-114855238 GAGGGTCTGTGAGTCCTCTTAGG - Intergenic
1015825504 6:137306826-137306848 TAGTTTCTGTGACCCACCTTGGG - Intergenic
1017953996 6:159162957-159162979 TACTATCTGTGAGCTGTGTTAGG + Intergenic
1023438116 7:40159318-40159340 TGGTTTCTGTGACCCTTCTTAGG + Intronic
1023881177 7:44322615-44322637 TAGTGTCTGTGAGCCCTGCCAGG + Intronic
1028951768 7:96644349-96644371 CAGAATCTGGGAGCACTCTTTGG - Intronic
1032352678 7:131180287-131180309 TAGGATCTGTGATTGCTCTTGGG - Intronic
1037587572 8:20288529-20288551 TAGTAACAGTGCACCCTCTTGGG - Intronic
1039038805 8:33387369-33387391 TAGTATCTGAGAGCCCCATATGG + Intronic
1046820479 8:118629352-118629374 TAGTATCTGTTAGGTATCTTCGG + Intergenic
1047740373 8:127801777-127801799 TGGTAGCTGTGAGCCCTATGTGG + Intergenic
1050743655 9:8851798-8851820 TATTATCTGTGAGCTCTCGGAGG - Intronic
1050886686 9:10775835-10775857 TAGTATCTGTCTCCACTCTTGGG + Intergenic
1054893874 9:70285193-70285215 TCTTAGCTGTGAGCCCTCCTAGG - Intronic
1062725232 9:138069380-138069402 AAGTGTCTGTGAGTCATCTTTGG + Intronic
1186921844 X:14291050-14291072 TAGTAGCTTTTAGACCTCTTGGG + Intergenic
1188832183 X:34912428-34912450 TGGTACCTGTTAGCACTCTTTGG + Intergenic
1189474747 X:41342250-41342272 TGGCATCTGTGAGGCCTTTTAGG + Intronic
1191272523 X:58494244-58494266 CGGTATTTGTGAGCCCTTTTTGG + Intergenic
1191272821 X:58499528-58499550 CGGTATTTGTGAGCCCTTTTTGG + Intergenic
1192820086 X:74636404-74636426 TAGGGTCTGTGGGTCCTCTTGGG - Intergenic
1195490531 X:105463816-105463838 TAGTATCTGTCCTCCCACTTTGG + Intronic
1195490583 X:105464653-105464675 TAGTATCTGTCCTCCCACTTTGG - Intronic