ID: 1138673453

View in Genome Browser
Species Human (GRCh38)
Location 16:58633746-58633768
Sequence TTGTCTGTAGGGAGAGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138673446_1138673453 -5 Left 1138673446 16:58633728-58633750 CCCAACTAACACCAATGTTTGTC No data
Right 1138673453 16:58633746-58633768 TTGTCTGTAGGGAGAGGAGTGGG No data
1138673442_1138673453 -1 Left 1138673442 16:58633724-58633746 CCCCCCCAACTAACACCAATGTT No data
Right 1138673453 16:58633746-58633768 TTGTCTGTAGGGAGAGGAGTGGG No data
1138673447_1138673453 -6 Left 1138673447 16:58633729-58633751 CCAACTAACACCAATGTTTGTCT No data
Right 1138673453 16:58633746-58633768 TTGTCTGTAGGGAGAGGAGTGGG No data
1138673443_1138673453 -2 Left 1138673443 16:58633725-58633747 CCCCCCAACTAACACCAATGTTT No data
Right 1138673453 16:58633746-58633768 TTGTCTGTAGGGAGAGGAGTGGG No data
1138673444_1138673453 -3 Left 1138673444 16:58633726-58633748 CCCCCAACTAACACCAATGTTTG No data
Right 1138673453 16:58633746-58633768 TTGTCTGTAGGGAGAGGAGTGGG No data
1138673445_1138673453 -4 Left 1138673445 16:58633727-58633749 CCCCAACTAACACCAATGTTTGT No data
Right 1138673453 16:58633746-58633768 TTGTCTGTAGGGAGAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138673453 Original CRISPR TTGTCTGTAGGGAGAGGAGT GGG Intergenic
No off target data available for this crispr