ID: 1138673868

View in Genome Browser
Species Human (GRCh38)
Location 16:58636811-58636833
Sequence CGGTGGGAATGGGGAGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138673856_1138673868 13 Left 1138673856 16:58636775-58636797 CCAGGAAACTACTGTAAGAGTCC No data
Right 1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG No data
1138673863_1138673868 -8 Left 1138673863 16:58636796-58636818 CCAGGGGAGATAGTGCGGTGGGA No data
Right 1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138673868 Original CRISPR CGGTGGGAATGGGGAGAACT GGG Intergenic
No off target data available for this crispr