ID: 1138679520

View in Genome Browser
Species Human (GRCh38)
Location 16:58674936-58674958
Sequence AGGGCTGCTGGGAGTCATCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138679520_1138679527 -3 Left 1138679520 16:58674936-58674958 CCTCGATGACTCCCAGCAGCCCT 0: 1
1: 0
2: 1
3: 24
4: 192
Right 1138679527 16:58674956-58674978 CCTCGAGGCCCAACAGGATCTGG 0: 1
1: 0
2: 0
3: 20
4: 145
1138679520_1138679524 -9 Left 1138679520 16:58674936-58674958 CCTCGATGACTCCCAGCAGCCCT 0: 1
1: 0
2: 1
3: 24
4: 192
Right 1138679524 16:58674950-58674972 AGCAGCCCTCGAGGCCCAACAGG 0: 1
1: 0
2: 1
3: 7
4: 119
1138679520_1138679530 15 Left 1138679520 16:58674936-58674958 CCTCGATGACTCCCAGCAGCCCT 0: 1
1: 0
2: 1
3: 24
4: 192
Right 1138679530 16:58674974-58674996 TCTGGCTGCCAGTGCCTGTCTGG 0: 1
1: 0
2: 1
3: 28
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138679520 Original CRISPR AGGGCTGCTGGGAGTCATCG AGG (reversed) Intronic
901025652 1:6277500-6277522 AGGGCTGGTGGGAGTCTATGGGG - Intronic
902771670 1:18648756-18648778 AGGGCAGCGGGGAGCCATGGAGG + Intronic
903473265 1:23602128-23602150 AGGGGAGCTGGGAGTCACTGCGG - Intronic
903847864 1:26289241-26289263 AGGGCTGCTGTGAGGCTTGGAGG + Intronic
904616905 1:31754901-31754923 AGGGCTGCTAGGAGTGCTGGAGG - Intronic
905357314 1:37393837-37393859 AGAGCTGTTGGGAGCCAGCGAGG + Intergenic
906656867 1:47554490-47554512 AGGGCTTCTGGGGATCATGGAGG + Intergenic
907319248 1:53592522-53592544 AGGGCTGCTGGGAGACAGCTGGG - Intronic
909499677 1:76320235-76320257 TGGCCTACTGGGAGTCATAGGGG - Intronic
910163494 1:84298802-84298824 GGGGCTGCTGGCAGTGCTCGGGG + Intronic
912631587 1:111251140-111251162 AGAGCTGCTGGGTGTCAGCTGGG - Intergenic
915593111 1:156881701-156881723 GGGGCTGCTGGGAGCTATGGGGG - Intronic
917002681 1:170376660-170376682 TGGGCTGCTGAGAGTCATAGTGG + Intergenic
918554050 1:185778154-185778176 AGAGCTGCTGGGATTAATCAGGG - Intronic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
921758035 1:218881983-218882005 AGGACTGCTGGGAGTTCCCGTGG - Intergenic
922057296 1:222053277-222053299 AGGGCTGCTGGGAAGCCCCGTGG - Intergenic
922822537 1:228494151-228494173 AGAGCTGCCGGGACTCATGGAGG - Exonic
1062829066 10:593419-593441 GGGTCTGCTGGGAGACAGCGGGG - Intronic
1067414112 10:46091089-46091111 TGGGCTGCAGGGAGTCAGAGGGG + Intergenic
1067439530 10:46300726-46300748 TGGGCTGCAGGGAGTCAGAGGGG - Intronic
1068819176 10:61353164-61353186 AAGGCTGCTGGGACTTATAGCGG - Intergenic
1069931969 10:71889080-71889102 AGGTCTGCTGGGACGCAGCGCGG + Intergenic
1072878718 10:99203280-99203302 AGGGCTGCAGGGAGCCATCTTGG - Intronic
1073289061 10:102404493-102404515 AAGGCTGCTGCGTGTGATCGTGG - Intronic
1074981234 10:118621417-118621439 AGGGCTGCAGGATGTCATCAGGG - Intergenic
1075413989 10:122249183-122249205 AGGGCTGCTGGGAGGCCCCTGGG - Intronic
1075428857 10:122364127-122364149 AGGGCTGCTGGGGGTCGGCCAGG - Intergenic
1075702357 10:124477848-124477870 AGGGCTGCAGGGAATCCTCGGGG - Intronic
1076876011 10:133215843-133215865 AGGGCTGCTGGCACCCAGCGTGG + Intronic
1077445442 11:2588521-2588543 AGGGCTGCTGGGGGTCACGTGGG - Intronic
1077564039 11:3284957-3284979 AAGGCTACTGTGAGTCACCGAGG - Intergenic
1077569929 11:3330774-3330796 AAGGCTACTGTGAGTCACCGAGG - Intergenic
1083048139 11:59754923-59754945 AGGGCTGCTGGCAGTGAAAGTGG - Intronic
1083639056 11:64135650-64135672 ACGGCTGCCAGGAGTCCTCGAGG + Intronic
1084421578 11:69063176-69063198 AAGGCTGCTGGGAGGCTTCTGGG - Intronic
1084498849 11:69522690-69522712 AGGCCTGCTGGGAGGTGTCGGGG - Intergenic
1084683730 11:70681672-70681694 AGGGTTGCTGTGAGTAATCTGGG - Intronic
1085464973 11:76717031-76717053 AGGGCCCCTGGGAGTCATTCTGG + Intergenic
1086399659 11:86450101-86450123 GGGCCTCCTGGGAGTCATTGAGG - Intronic
1088460359 11:110076054-110076076 AGTCCTGCTGGGAGTCACAGTGG + Intergenic
1088546590 11:110965623-110965645 AGGGCTGCTGGGGGTTGTAGGGG + Intergenic
1089208271 11:116782924-116782946 AGGGCTGCTGAAAGACATCCGGG - Exonic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1090737624 11:129624113-129624135 AGGGAAGCTGGGAGACATCTTGG + Intergenic
1093435549 12:19130488-19130510 ACGGCAGCTGGGGGTCACCGGGG - Intronic
1096452489 12:51756063-51756085 AGGCCTACTGTGAGGCATCGGGG - Intronic
1097182883 12:57180959-57180981 AGGGCTGCTGGGAGCCTACAAGG - Intronic
1102028309 12:109726004-109726026 AGGGTTGCTGGGGGTCAGCCAGG + Intronic
1103196067 12:119044682-119044704 AGGGCTGCTGGGAGGAACCAGGG + Intronic
1103939833 12:124495662-124495684 AGGGGGGCTGGGAGCCATCTGGG - Intronic
1104629074 12:130384636-130384658 AGAGCTGCTGGGGTGCATCGTGG + Intergenic
1105594193 13:21820611-21820633 AGGGATGCTAAGAGTCATCATGG + Intergenic
1106359283 13:29014983-29015005 AGTGCACCTGGGAGTCATCCCGG - Intronic
1118156619 14:63248846-63248868 GGAGCTGCTGGGAGCCATCTGGG - Intronic
1119380848 14:74227341-74227363 GGGGCATCTGGGAGTCATCGAGG + Intergenic
1121231034 14:92358598-92358620 AGGGGTGCAGGAAGACATCGAGG - Intronic
1122788688 14:104175463-104175485 AGGGGTGCTGGCAGCCATCGGGG - Exonic
1123210146 14:106751726-106751748 AATGCTGCTGGCAGTGATCGTGG - Intergenic
1124261069 15:28191973-28191995 AGCCCTGCTGGCAGTCATCGGGG - Exonic
1124374116 15:29119977-29119999 AGGGCTGCTGGGAGGAATGCAGG - Intergenic
1125592599 15:40864185-40864207 AGGTCTGCTGGGAGCCAGGGAGG + Intergenic
1126960124 15:53983342-53983364 AGGGCTGCAGGGAGCTCTCGTGG + Intergenic
1127327713 15:57911752-57911774 AGAGCTGCTAGTAGTCATCTGGG + Intergenic
1128336342 15:66788178-66788200 AGGGCTGCTGGAAGTCCTCAAGG - Intergenic
1131742490 15:95409407-95409429 AGGGCAGCTGGGAGGCATTTTGG + Intergenic
1132574302 16:657566-657588 AGGGGAGCTGGGAGTCCCCGTGG - Intronic
1132578193 16:673525-673547 GGGGCTGCTGGGGGTTGTCGGGG + Exonic
1132790896 16:1687045-1687067 AAGGCTGCAGTGAGTCATGGTGG - Intronic
1132942325 16:2514340-2514362 AGGGCTGCGGGGAGCCGCCGGGG + Intronic
1134091896 16:11395999-11396021 AGGGCTGCTGGGAGTAAGGAGGG + Intronic
1134431424 16:14211399-14211421 TGGGCTCCTGGGAGTCTTTGTGG + Intronic
1136637843 16:31537306-31537328 AGGGCGGCCGGGAGGCATCGAGG - Intergenic
1137389904 16:48072631-48072653 AAGGCTGCTGAGAGTCCTCCTGG - Intergenic
1137621856 16:49881442-49881464 ATGGCTGCAGGGAGTATTCGAGG + Intergenic
1138445498 16:57060817-57060839 AGGGCTGCTGGGATACTTCCAGG - Intronic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1139361278 16:66401726-66401748 AGGGTTGCCGGGAGGCAGCGTGG + Intronic
1139940322 16:70600933-70600955 AGGGCTGCTGGGAGGAGTAGGGG + Intronic
1140288004 16:73622737-73622759 AGAGCTGCTGGGAGTCATGAAGG - Intergenic
1140624729 16:76778684-76778706 AGGGCCACTGTGAGTCATCTTGG + Intergenic
1141096582 16:81167414-81167436 AGGGCTTCTGGGAGGCAGTGTGG - Intergenic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142288107 16:89179647-89179669 AGGTCTCCTGGGAGCCAGCGGGG + Intronic
1142527160 17:551500-551522 AAGGCTGCAGGGAGTCATGGTGG + Intronic
1144814106 17:18021294-18021316 AGGGCTGCTGGGACTCACAAGGG - Intronic
1144960105 17:19039976-19039998 AGGGCAGTTGGGAGCCATGGAGG - Intronic
1144975055 17:19134548-19134570 AGGGCAGTTGGGAGCCATGGAGG + Intronic
1145900999 17:28490498-28490520 GGGGCTGCTGGTGGCCATCGCGG + Exonic
1146172050 17:30641935-30641957 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146345508 17:32057971-32057993 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1147448198 17:40487796-40487818 AGGGCTCCTGGGAGTCATGGGGG - Intronic
1150733755 17:67717904-67717926 AGGCCTGCCGGGAGTGAGCGCGG + Exonic
1151889907 17:76945941-76945963 TGGGGTGCTGGGAGTCACCAAGG + Intronic
1151927113 17:77206295-77206317 AGCGCTGCTGCGGATCATCGAGG + Exonic
1152290164 17:79435808-79435830 AAGGTGGCTGGGAGACATCGGGG - Intronic
1152386106 17:79975739-79975761 AGGGCTGCTGGGAGCGTTAGTGG - Intronic
1152822031 17:82442335-82442357 AGGGCTGGTGGGTGGCAGCGGGG - Exonic
1156446382 18:37240127-37240149 AGGACTGCTGCTAGTCATCTGGG - Intergenic
1160298702 18:77659468-77659490 ATGGATGCTGGGAGGCCTCGTGG + Intergenic
1161238846 19:3210804-3210826 AGGGCAGCTGGGAGCCATGGAGG + Intergenic
1161502106 19:4622052-4622074 AGGGCAGCTGGAGGTCATCATGG - Intergenic
1161739237 19:6010272-6010294 AGGGCTGCTGGGCCTCATGATGG - Intronic
1161857477 19:6773845-6773867 AGGGCTGCTGGGTGGGAACGGGG + Intronic
1164650034 19:29884825-29884847 AGGGTTGCGGGGAGCCATTGGGG + Intergenic
1164989493 19:32674311-32674333 AGGGCTGCTGGCAGTGCTGGAGG - Intronic
1167740244 19:51320307-51320329 AGGGCCCCCGGGAGTCATTGGGG + Intronic
925535997 2:4917239-4917261 AGGGCAGCTGGGAATTACCGAGG - Intergenic
925913238 2:8586877-8586899 AGGGCTGCTGTGATTCATGGTGG + Intergenic
927192964 2:20529527-20529549 AGTGCTGCTGGGAGCCACTGAGG + Intergenic
927680910 2:25138403-25138425 AAGGCTACTGGGAGTCAGGGTGG + Intronic
930066591 2:47332476-47332498 ATGGCTGCTGGGAGACCTCCAGG + Intergenic
932702248 2:73999975-73999997 AGGGCTGCTGGAAGGCAGGGTGG + Intronic
932767720 2:74481988-74482010 AGGGCTGCTGGGCCTGGTCGGGG - Exonic
933729171 2:85444513-85444535 AGGGCTGGTGGGGGGCATCGGGG - Intergenic
933909526 2:86927632-86927654 AAGGCTTCTGGGAGACATCATGG + Intronic
934023199 2:87975747-87975769 AAGGCTTCTGGGAGACATCATGG - Intergenic
935502421 2:103857591-103857613 AGGGCAGCTAGGATACATCGAGG - Intergenic
936413355 2:112280658-112280680 AAGGCTTCTGGGAGACATCATGG + Intronic
937986296 2:127639655-127639677 AGGGCTGTGGGGAGGCATAGAGG - Intronic
938605734 2:132890831-132890853 AGGGCTGCTGGGCATCTTGGAGG + Intronic
941222114 2:162795477-162795499 AGAGCTGCTAGGAGTCAATGGGG - Intronic
944818587 2:203405574-203405596 AGGGCTACTGGGAGTAATACAGG - Intronic
946225615 2:218262720-218262742 AGTGCTGTTGGGCGTCATCTTGG - Exonic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947670902 2:231934750-231934772 AGGACTGCTGGGACTCACCTGGG + Intergenic
947716622 2:232342972-232342994 AGGGCTGATAGGAGTCAGAGTGG + Intronic
948693990 2:239723561-239723583 AGGGCAGCTGGGACTCATCCAGG - Intergenic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
949042199 2:241854579-241854601 AGGGCTCCTGGGAGGCAGCCTGG + Intronic
1168858026 20:1023016-1023038 AGGGCTGCAGTGAGTCAATGGGG - Intergenic
1169673993 20:8133330-8133352 AGGGCTGCGGGGACACATCTGGG + Intronic
1171227425 20:23453127-23453149 AGGGCCCCTGGGAGTCCTGGAGG + Intergenic
1173026347 20:39310831-39310853 CGGGCTGCTGGGAGGCCTCCTGG + Intergenic
1174010068 20:47442467-47442489 AGAGCTGCTGGCAGCCATCTTGG - Intergenic
1174478274 20:50812878-50812900 AAGGCTGCTGTGAGCCATCATGG - Intronic
1175237887 20:57526051-57526073 AGGGGTGCTGGGAGACTTGGGGG + Intergenic
1175237908 20:57526108-57526130 AGGGGTGCTGGGAGACCTGGGGG + Intergenic
1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG + Intergenic
1176164030 20:63663564-63663586 AGGGCTTCTGGGGCTCATCACGG + Intronic
1178775352 21:35544943-35544965 AGGGCTGTTGGCAGTCATCTGGG - Intronic
1181166627 22:20987468-20987490 AGGGGTGGTGAGAGTCAGCGGGG - Intronic
1181581581 22:23831769-23831791 AAGGCTGCTGGGAGCCCTCACGG + Intronic
1182270701 22:29151483-29151505 AGGGCTTGTTGGAGTCATCCAGG - Intronic
1182279562 22:29209869-29209891 AGGGCTATAGGGAGTCATGGTGG + Intronic
1183815397 22:40295975-40295997 AGGAGTGCTGGGAGTCTTCGAGG + Intronic
1184091318 22:42294446-42294468 AAGGCTGCTGGGGGTCGGCGTGG + Intronic
1185061979 22:48611875-48611897 AGGGCTGCTGAGAGTCAGGAGGG + Intronic
950372932 3:12546399-12546421 AGGGCTGTTGTGACTCATCTGGG + Intronic
950506035 3:13395135-13395157 AGGGCTGCTGGGCACCATCCTGG + Intronic
950864946 3:16181595-16181617 AGGGGTGTGGGGAGTCATCTTGG - Intronic
952965596 3:38619179-38619201 AGGTGTGATGGGAGTCACCGGGG - Intronic
953797011 3:45993715-45993737 AGGGCTGCTTGCAGTGAACGTGG + Intronic
954217918 3:49134627-49134649 AGGGCCACTGGGGGACATCGTGG + Intergenic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
959236977 3:103736972-103736994 AAGGCTGCTCAGAGTCATCAAGG - Intergenic
960157337 3:114309190-114309212 AGGGGGGCTGGGAGTGATAGAGG + Exonic
962213687 3:133501610-133501632 GGGGCTGCTGCTGGTCATCGGGG + Intergenic
962924685 3:139980904-139980926 ATGGCTGCTGGAAGTCAGTGTGG - Intronic
963315612 3:143755202-143755224 GGGGCTGCTGGGGATCATCCTGG - Intronic
963603789 3:147397542-147397564 AGGGCTCCTGGAAGTACTCGGGG + Intronic
966580919 3:181561871-181561893 AAGGCTGCAGGGAGTTATCAGGG + Intergenic
967970240 3:194994148-194994170 GGGGCAGCTGGGAGGCAGCGAGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
970454996 4:16214706-16214728 AGGGGTGCTGAGGGTCATTGAGG - Intronic
972615139 4:40690944-40690966 AGGGCAGCTGGGAGCCACTGGGG - Intergenic
975549478 4:75596513-75596535 GGGGCTGCTGGGAGGCATGAGGG - Intronic
979521158 4:121668552-121668574 ATGGCTTCTGTGAGTCATGGAGG - Intronic
980063402 4:128155823-128155845 AGGGCTGCAGCGAGAGATCGAGG + Intronic
982546214 4:156736414-156736436 AAAGCTGCTGGGAGTCTTGGTGG + Intergenic
988993531 5:36693350-36693372 CGGGCTGCTCTGGGTCATCGGGG - Intergenic
990936231 5:61152873-61152895 AGTGCTGCTGGGAGCCACTGAGG - Exonic
996535905 5:124577572-124577594 AAGGCTTCTGGGAGACATTGGGG - Intergenic
997828308 5:137127409-137127431 AGGGCTGCCTGGAGCCATCAGGG + Intronic
998476517 5:142426883-142426905 TGACCTGCTGGGAGTCATAGCGG + Intergenic
999313640 5:150569820-150569842 AGGGCTGTTGAGGGTCATCCAGG - Intergenic
1002483401 5:179517976-179517998 AGGTCTCCTGGGAGTCAGAGGGG + Intergenic
1003015902 6:2467271-2467293 AGGGGTGCTGGGATGCATGGAGG - Intergenic
1003327632 6:5104801-5104823 AGGGCTGCAGGGAGTCTAGGAGG - Intronic
1003869363 6:10390081-10390103 AGGGCTGATGGGAGCCAGCGAGG + Intergenic
1006640214 6:35485809-35485831 CGGGCTGCTGGGAGGAATAGGGG + Intronic
1007169083 6:39849898-39849920 CGTGCTGCTGGGAGTCACCCAGG - Intronic
1009354717 6:62728040-62728062 AGGACTGCTGGGGTTCATGGTGG + Intergenic
1010490032 6:76464962-76464984 AGGGTTCCTGGGATTCATCCAGG - Intergenic
1016932697 6:149426036-149426058 AGGGATGCTGGGAGTGACAGGGG + Intergenic
1018725269 6:166607600-166607622 AGGGCTGCAGGGGGTCGTGGAGG + Intronic
1018869326 6:167769174-167769196 AGGGCTGACGGGAGTCATGGTGG + Intergenic
1018978197 6:168581772-168581794 GGGGCTGCAGGGAGGCAGCGGGG - Intronic
1019041904 6:169112869-169112891 AGGGTTGCTGCGTGTCATGGCGG - Intergenic
1023860084 7:44213322-44213344 TGGGGTGCTGGGAATCCTCGGGG - Exonic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024878244 7:54052968-54052990 AGGGCTGCTGGGATTAAGAGAGG - Intergenic
1025176153 7:56803472-56803494 AGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1032306094 7:130733719-130733741 AGGGCTCCTGGGAGAACTCGGGG - Exonic
1032471453 7:132182066-132182088 AGGGCTGATGGGGTTCATGGAGG - Intronic
1033276967 7:139979060-139979082 AGAGCTCCTGGGAGTTATCTTGG + Intronic
1034893545 7:154860457-154860479 AGGGCTGCTGGGGGCCATGGTGG + Intronic
1037946793 8:22994604-22994626 AGGTCTTCTGGGGGCCATCGGGG - Exonic
1038390100 8:27189505-27189527 AAGGCTGATGGGAGTCCTCAAGG + Intergenic
1040287086 8:46105961-46105983 CGGGCTGCAGGGACTCAGCGTGG - Intergenic
1045621909 8:103988403-103988425 AGGGCTGTTGCGTGTCATCATGG + Intronic
1056881235 9:90395868-90395890 AGGGCAGCTGGGAGTGACAGTGG - Intergenic
1056967802 9:91179136-91179158 GGGGCTGCAGGGAGTCATCAGGG + Intergenic
1057879766 9:98784266-98784288 TGGGCTGCTGGGCATCATAGGGG + Intronic
1060426286 9:123509434-123509456 AGGGCTGCTGGGAGCATTAGGGG + Intronic
1061750373 9:132772908-132772930 AGGGCTGTTGGCAGTAATCCAGG - Intronic
1061949893 9:133930319-133930341 AAGGCTGCTGGGAGGCAGTGTGG - Intronic
1062318251 9:135978515-135978537 AGGGCTGCTGGGGGGGATTGAGG - Intergenic
1185913030 X:4003319-4003341 AGGGCTTGAGGGAGTCATCTTGG + Intergenic
1186665735 X:11715101-11715123 AGGGATGCAGGGAGACTTCGAGG - Intergenic
1192503159 X:71666200-71666222 AGGGCTGCTGGGGGTCCACGCGG + Intergenic
1192510366 X:71717578-71717600 AGGGCTGCTGGGGATCCACGCGG + Exonic
1192516331 X:71763975-71763997 AGGGCTGCTGGGGATCCACGCGG - Exonic
1192529489 X:71872710-71872732 AGGGCTGCTGGGGATCCACGTGG + Intergenic
1192962858 X:76148544-76148566 AGGGCTGCTGGTTGTCACGGGGG + Intergenic
1193849088 X:86513779-86513801 ACAGCTGCTGGGAGCCAACGAGG - Intronic
1195062515 X:101209956-101209978 AGGGTTGCTGGGAGAAATTGGGG + Intergenic
1200246862 X:154531107-154531129 AGTGTTGCTGGAAGTCATCTTGG + Intergenic