ID: 1138680451

View in Genome Browser
Species Human (GRCh38)
Location 16:58680167-58680189
Sequence CCTTACAACCACATGCCTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 154}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138680442_1138680451 14 Left 1138680442 16:58680130-58680152 CCCGAGAGCCTTCTTCCTGCAAG 0: 1
1: 0
2: 2
3: 22
4: 216
Right 1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG 0: 1
1: 0
2: 0
3: 24
4: 154
1138680440_1138680451 21 Left 1138680440 16:58680123-58680145 CCATGGCCCCGAGAGCCTTCTTC 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG 0: 1
1: 0
2: 0
3: 24
4: 154
1138680445_1138680451 6 Left 1138680445 16:58680138-58680160 CCTTCTTCCTGCAAGGTCTGTGG 0: 1
1: 0
2: 1
3: 26
4: 321
Right 1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG 0: 1
1: 0
2: 0
3: 24
4: 154
1138680443_1138680451 13 Left 1138680443 16:58680131-58680153 CCGAGAGCCTTCTTCCTGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 250
Right 1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG 0: 1
1: 0
2: 0
3: 24
4: 154
1138680439_1138680451 27 Left 1138680439 16:58680117-58680139 CCTGGGCCATGGCCCCGAGAGCC 0: 1
1: 1
2: 1
3: 14
4: 221
Right 1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG 0: 1
1: 0
2: 0
3: 24
4: 154
1138680441_1138680451 15 Left 1138680441 16:58680129-58680151 CCCCGAGAGCCTTCTTCCTGCAA 0: 1
1: 0
2: 3
3: 19
4: 100
Right 1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG 0: 1
1: 0
2: 0
3: 24
4: 154
1138680448_1138680451 -1 Left 1138680448 16:58680145-58680167 CCTGCAAGGTCTGTGGGTTCTGC 0: 1
1: 0
2: 1
3: 21
4: 291
Right 1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG 0: 1
1: 0
2: 0
3: 24
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138680451 Original CRISPR CCTTACAACCACATGCCTCA GGG Exonic
901290755 1:8122480-8122502 ACTAACAACCACATACCTAAAGG + Intergenic
903018444 1:20377060-20377082 CATTACCACCACAGGCCTGAGGG + Intergenic
903309768 1:22445463-22445485 CCTTACCACCACATCACTAAAGG + Intergenic
907090997 1:51725548-51725570 CCTTACCACCACATTACTAAAGG - Intronic
911248274 1:95544304-95544326 CCTTACAGCCACATCCTTCTTGG + Intergenic
917013462 1:170502092-170502114 CCTTCCTGCAACATGCCTCATGG - Intergenic
917782558 1:178413487-178413509 CCTTACTACTACATGACTAAAGG + Intronic
919183231 1:194112279-194112301 CCTTGCAATCAAATTCCTCAAGG + Intergenic
922101119 1:222477548-222477570 CCTTACAGCTCCATGGCTCAGGG + Intergenic
923342972 1:233023091-233023113 CCTTCCAGCCACTTGCTTCACGG + Intronic
1063933833 10:11056941-11056963 CCTTCTAACCACATGCTTCTGGG + Intronic
1064766846 10:18683926-18683948 CTTTAGAACCACATGCATCTGGG - Intergenic
1066020260 10:31291709-31291731 CCTTAGAACAGCATGACTCAAGG + Intergenic
1066822040 10:39507418-39507440 CCCTTCAACCATAGGCCTCAAGG - Intergenic
1067451313 10:46383804-46383826 CCCTACTACCACAGTCCTCAAGG - Intronic
1067546574 10:47196466-47196488 CCTGACAGCCACATGCCCCTTGG + Intergenic
1067585929 10:47475952-47475974 CCCTACTACCACAGTCCTCAAGG + Intronic
1069647261 10:70009694-70009716 CCTTACCACCACATCACTGAAGG + Intergenic
1071552588 10:86578501-86578523 CCTTACCACCACAGGACTAAAGG - Intergenic
1072120057 10:92398171-92398193 CCTCACCACCACATCACTCAAGG + Intergenic
1072199921 10:93149199-93149221 CCACAAAGCCACATGCCTCAGGG - Intergenic
1076384550 10:130046916-130046938 GCTTACACACACACGCCTCAGGG - Intergenic
1076696679 10:132250610-132250632 CCTCACACCCACCTGCCTCGGGG - Intronic
1078591414 11:12643300-12643322 CCTTACCACCACATTACTGAAGG + Intergenic
1079312691 11:19380476-19380498 CTGCACACCCACATGCCTCATGG - Intronic
1082261496 11:50078951-50078973 CCTTACATCTCCATGGCTCAGGG + Intergenic
1082362077 11:51667818-51667840 CTTTTCCACCACAGGCCTCATGG - Intergenic
1082406052 11:52306637-52306659 CTTTTCCACCACAGGCCTCAAGG - Intergenic
1084261279 11:67980402-67980424 CCTTACACCCACAGTCCTCCAGG + Intergenic
1085405159 11:76257302-76257324 CCTGGGAACCACATGCCCCAGGG + Intergenic
1085431631 11:76455586-76455608 CCTTTCAACCACATTCCTTCAGG - Intronic
1088053300 11:105544934-105544956 CCTTCCCACCACCTGCCCCAGGG - Intergenic
1090768662 11:129898940-129898962 CCTTACCACCACATTGCTAAAGG - Intergenic
1091227392 11:133965832-133965854 CATTGCAACCACATCCCACAGGG - Intergenic
1093697755 12:22181318-22181340 CCTTACAACCACACGAATAAAGG + Intronic
1095077001 12:37942876-37942898 CTTTATCACCACAGGCCTCAAGG + Intergenic
1097456371 12:59803635-59803657 CCTTACCACCACATTACTAAAGG - Intergenic
1101419099 12:104534540-104534562 CATTACAAACACATACCTGAAGG + Intronic
1101649777 12:106667008-106667030 CCTTACCACCATATGACTAAAGG - Intronic
1104141308 12:125988531-125988553 CATCACAACCCCATGCCTCTGGG + Intergenic
1108985925 13:56587236-56587258 TTGTACAACCACATGACTCAGGG + Intergenic
1109757913 13:66786221-66786243 ACATACAGCCACATGCATCAAGG + Intronic
1116811048 14:49540602-49540624 CCTTACCACCACATCACTTAAGG + Intergenic
1119529043 14:75346604-75346626 CCTGACTAACACATGCCTCGTGG + Intergenic
1120007127 14:79371226-79371248 CCTTACAAACACATGACTAAAGG - Intronic
1120364690 14:83551014-83551036 CCTTATAACAACATGACTGATGG - Intergenic
1122257053 14:100486188-100486210 CCTGACAACCACGTCCCTTATGG + Intronic
1127162863 15:56208439-56208461 CCTTACTACCACATTACTAAAGG + Intronic
1130876540 15:88019419-88019441 CCAGGCAACCATATGCCTCAGGG + Intronic
1131002417 15:88949575-88949597 CCTTCCAAACACATCCTTCAGGG - Intergenic
1131524550 15:93142705-93142727 ACTTACTAACACATCCCTCATGG + Intergenic
1136568796 16:31084821-31084843 CCTGACCACCACCTGCCTGATGG - Exonic
1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG + Exonic
1140770805 16:78202281-78202303 CCTTTCTACCAGAGGCCTCATGG - Intronic
1143118953 17:4595634-4595656 CCTCACACCCACATTCCCCAGGG + Intronic
1143530569 17:7500816-7500838 CCTTACAAGCACATCTCTCCTGG + Exonic
1143717211 17:8782684-8782706 CCTTACCACCACATTACTAAAGG + Intergenic
1144501375 17:15788536-15788558 CCTAACCACCACATGCGACATGG + Intergenic
1145163550 17:20591210-20591232 CCTAACCACCACATGCGACATGG + Intergenic
1145348394 17:22056574-22056596 CCCTACAACCACATACCTTGGGG + Intergenic
1145999792 17:29124380-29124402 GCTGAGAACCACATGCCACATGG + Intronic
1148287569 17:46409027-46409049 CCTCACAATCACATGCCTAAAGG - Intergenic
1148309737 17:46626606-46626628 CCTCACAATCACATGCCTAAAGG - Exonic
1148648942 17:49235780-49235802 CCTGACCACCACTTGCCACACGG - Intergenic
1149183528 17:53969890-53969912 CCTAGCAACAACATGCCTGAAGG - Intergenic
1153989840 18:10386411-10386433 CCTTACAAGCTCATTCCTCAGGG - Intergenic
1157557541 18:48622506-48622528 CCTTGCTCCCACATTCCTCAAGG - Intronic
1158461462 18:57649607-57649629 CCTCACAGCCACATTTCTCATGG + Intronic
1159461577 18:68727639-68727661 CCTTTCTACCAGTTGCCTCAAGG + Intronic
1160056166 18:75482914-75482936 CCTTACCACCACATTACTAAAGG + Intergenic
1164368579 19:27618178-27618200 CTTTTCCACCACAGGCCTCAAGG - Intergenic
931496077 2:62808737-62808759 CCTTACCATCACATTACTCAAGG - Intronic
932888559 2:75570243-75570265 CCTTAGAAGAACTTGCCTCAGGG - Intergenic
933600337 2:84322622-84322644 CATTTCAAGCAGATGCCTCAGGG + Intergenic
933795859 2:85919039-85919061 CCTTGAATCCAGATGCCTCATGG + Intergenic
935219248 2:100998274-100998296 CTTTAAACCCACATGCGTCATGG + Intergenic
935440063 2:103082571-103082593 CCTTACCGCCACATTCCTGAAGG + Intergenic
938533399 2:132216666-132216688 CTTTTCTACCACAGGCCTCAAGG - Intronic
938533531 2:132219112-132219134 CCTTTCCACCATAGGCCTCAAGG - Intronic
939539340 2:143474313-143474335 CCTGAAAAATACATGCCTCAAGG - Intronic
942408080 2:175676693-175676715 CCGTGCAGTCACATGCCTCAGGG + Intergenic
942969780 2:181944146-181944168 CCTTACAATCGCTTGCCTCAGGG + Intergenic
944475642 2:200102304-200102326 CCCTACAATCACCTGCCTGAAGG - Intergenic
1169135035 20:3192077-3192099 CAAAACAACCACCTGCCTCATGG + Intronic
1170587552 20:17746320-17746342 CCTTTTAATCACATCCCTCAAGG - Intergenic
1170721333 20:18882247-18882269 CCTTACCACCACATCACTAAAGG - Intergenic
1170732678 20:18988271-18988293 GCTTACAGCCACATGCCACTCGG - Intergenic
1170734280 20:19000513-19000535 CCTTACAATCAGCTGCCTAAAGG - Intergenic
1171740381 20:28877978-28878000 CTTTTCAACCATACGCCTCAAGG + Intergenic
1171740629 20:28881377-28881399 CTTTACAACCATACGCCTCAAGG + Intergenic
1171740701 20:28882918-28882940 CTTTTCAATCATATGCCTCAAGG + Intergenic
1176924183 21:14726817-14726839 CCCCACAACCACACGCTTCATGG - Intergenic
1179052687 21:37902041-37902063 CCATAGAACCACATGACTCCAGG + Intronic
1182076617 22:27499467-27499489 CCTGGCACCCACAGGCCTCATGG - Intergenic
1185385300 22:50529135-50529157 CCTTGCAGCCACATGCCGCCAGG + Exonic
949092811 3:49471-49493 CATTTCAACTCCATGCCTCAAGG - Intergenic
951001711 3:17569497-17569519 ATTTACTACCATATGCCTCATGG - Intronic
956626772 3:71274334-71274356 CCTTAGAAGCACATGACCCAAGG + Intronic
959036980 3:101378086-101378108 TCTTACCACCACATTCCTAAAGG + Intronic
960399877 3:117183302-117183324 CCTTACAGCCAACTGCCCCAAGG + Intergenic
961569752 3:127789178-127789200 CCTGGCCACCACATGCCTCAGGG - Intronic
963313873 3:143738245-143738267 CCTTCCAGCCACATGCCACAGGG + Intronic
963947141 3:151158815-151158837 CCATAAAACCAACTGCCTCAAGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
968439585 4:616535-616557 TCTTACAACCACATCACTAAAGG - Intergenic
969024505 4:4162670-4162692 CCTTACACCCACAGTCCTCCAGG + Intergenic
969045453 4:4333352-4333374 CCTTAAAACCACAGGGCTGAAGG - Intergenic
969793639 4:9509203-9509225 CCTTACACCCACAGTCCTCCAGG - Intergenic
974489590 4:62547817-62547839 CCTTTCAACCACCTGCCCCATGG + Intergenic
977111484 4:92962289-92962311 CCTTACCACCACATTACTAAAGG - Intronic
979039005 4:115763011-115763033 CCTTACCACCACATTACTAAAGG + Intergenic
979258673 4:118630023-118630045 CCTTACAGCTCCATGGCTCAGGG - Intergenic
979545648 4:121937132-121937154 CCTGAGTACCACCTGCCTCAAGG + Intronic
982403780 4:154998351-154998373 CCCTACAACCACATTACTAAAGG - Intergenic
982844901 4:160238518-160238540 TCTTATAACCACATGGCCCAAGG - Intergenic
982922057 4:161288100-161288122 CCTTACCACCACATTACTAAAGG + Intergenic
986322754 5:6646403-6646425 CCTACCAACCAAATTCCTCAAGG - Intronic
987478399 5:18421009-18421031 CCTTACCACCACATGACTAAAGG + Intergenic
988904796 5:35775470-35775492 CCTTCCCAGAACATGCCTCATGG - Intronic
989835511 5:45984069-45984091 CCTTTTAACCACAAGCCTCAAGG - Intergenic
989855219 5:46278021-46278043 CTTTTCCACCATATGCCTCATGG + Intergenic
989856301 5:46297435-46297457 CTTTACCACCATAGGCCTCAAGG + Intergenic
993022073 5:82604054-82604076 CCTTACCACCACATTACTAAAGG + Intergenic
996023500 5:118617821-118617843 TCTCACAACGAAATGCCTCAAGG + Intergenic
996025087 5:118637034-118637056 CCTTACCACCACATTACTAAAGG - Intergenic
996199632 5:120655674-120655696 CCATGCAATCACATGACTCATGG + Intronic
998137934 5:139684218-139684240 CCTTACCCCCACCTGCCTCGTGG - Intergenic
1003329180 6:5115586-5115608 CCTCACAGCTACATGCCTTACGG - Intronic
1006168080 6:32077247-32077269 CCCTACAACCTCAGGCCCCAAGG + Intronic
1006750485 6:36373644-36373666 CCCTGCAGCCACCTGCCTCAGGG + Intronic
1010209449 6:73351629-73351651 CCTTCCAGCCACAGGTCTCAGGG + Intergenic
1014203357 6:118628069-118628091 CCTTACCACCACATTACTAAAGG + Intronic
1022783833 7:33615127-33615149 CCTTACCACCACATTACTAAAGG + Intergenic
1024458698 7:49637420-49637442 CCTTAGCACCAAATGCCTTAGGG - Intergenic
1025183004 7:56833379-56833401 CCTTACAGCTCCATGGCTCAGGG + Intergenic
1025312151 7:57961783-57961805 CCTTTCCACCACAGGCCTCAAGG + Intergenic
1025575701 7:62638514-62638536 CTTTATCACCACAGGCCTCAAGG + Intergenic
1025576200 7:62644962-62644984 CTTTATCACCATATGCCTCAAGG + Intergenic
1025576293 7:62646507-62646529 CTTTATCACCACGTGCCTCAAGG + Intergenic
1025576580 7:62651046-62651068 CTTTATCACCACAGGCCTCAAGG + Intergenic
1025688924 7:63743595-63743617 CCTTACAGCTCCATGGCTCAGGG - Intergenic
1025912137 7:65837775-65837797 CCTTACAGCTCCATGGCTCAGGG - Intergenic
1027817752 7:82998694-82998716 CCTTACCACCACATTACTAAAGG + Intronic
1029078336 7:97953241-97953263 CCTTACACCCACAGTCCTCCAGG + Intergenic
1031238638 7:119210694-119210716 CCTTCCCATCACAAGCCTCAAGG + Intergenic
1033985646 7:147222689-147222711 CCTTACCACCACATTACTAAAGG - Intronic
1034227223 7:149493592-149493614 CCTTACGGCAACATGCCTCGAGG - Intronic
1039758436 8:40547982-40548004 CCTGACAACCACATGCCAAATGG - Intronic
1040856120 8:51949799-51949821 CCCTACCCCCAAATGCCTCAGGG + Intergenic
1041334800 8:56770064-56770086 CCTTACCACCACATTACTAAAGG - Intergenic
1044038754 8:87338857-87338879 CCTTACAACCACATTACTAAAGG - Intronic
1047372923 8:124271088-124271110 CCTTAGAACCACAGCCCTCTGGG + Intergenic
1054701356 9:68416342-68416364 CATGAAAAACACATGCCTCAGGG - Intronic
1057330398 9:94108994-94109016 CCATAGACCCACTTGCCTCAAGG + Exonic
1058592121 9:106576355-106576377 CTTTAAAACCACAAGCCTCTGGG + Intergenic
1203374428 Un_KI270442v1:352622-352644 CTTTTCCACCACAGGCCTCAAGG - Intergenic
1203393198 Un_KI270509v1:390-412 CTTTTCCACCACAGGCCTCAAGG + Intergenic
1203396702 Un_KI270519v1:23949-23971 CTTTTCCACCACAGGCCTCACGG - Intergenic
1188807884 X:34614008-34614030 CCTTCCCATCACAGGCCTCAAGG - Intergenic
1191296615 X:58873984-58874006 CTTTACTACCACAGGCCTCAAGG - Intergenic
1191306064 X:58999390-58999412 CTTTTCCACCACAGGCCTCAAGG - Intergenic
1191341948 X:59479325-59479347 CTTTACTACCACAGGCCTCAAGG - Intergenic
1191350821 X:59598212-59598234 CTTTACTACCACAGGCCTCAAGG - Intergenic
1191351130 X:59602327-59602349 CTTTACTACCACAGGCCTCAAGG - Intergenic
1191381162 X:60003498-60003520 CTTTACTACCACAGGCCTCAAGG - Intergenic
1191403418 X:60301391-60301413 CTTTTCCACCACAGGCCTCAAGG - Intergenic
1191411201 X:60405936-60405958 CTTTACTACCACAGGCCTCAAGG - Intergenic
1191430606 X:60665859-60665881 CTTTTCCACCACAGGCCTCAAGG - Intergenic
1191435910 X:60736988-60737010 CTTTTCCACCACAGGCCTCAAGG - Intergenic
1191513419 X:61774135-61774157 CTTTACTACCACAGGCCTCAAGG - Intergenic
1191522889 X:61900658-61900680 CTTTACTACCACAGGCCTCAAGG - Intergenic
1191540312 X:62133913-62133935 CTTTACTACCACAGGCCTCAAGG - Intergenic
1191802432 X:65095909-65095931 ACTTACAACCACATCACTAAAGG + Intergenic
1194668824 X:96705772-96705794 CATTAGAATCACTTGCCTCAAGG + Intronic
1195714905 X:107809272-107809294 CCTTGCACCCACATGCCTCTCGG + Intergenic
1195726040 X:107917733-107917755 TCTTACAAACACTTGCCTCGTGG - Exonic
1196850123 X:119929672-119929694 CCTAACTGCCACATTCCTCATGG + Intronic
1198446168 X:136716489-136716511 CCTTACCACCACATTACTAAAGG + Intronic
1199871415 X:151901988-151902010 CCTTACCACCAAAAGCCACAAGG - Intergenic