ID: 1138693633

View in Genome Browser
Species Human (GRCh38)
Location 16:58791115-58791137
Sequence TCCAGCTGGCCCAGAAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138693629_1138693633 -6 Left 1138693629 16:58791098-58791120 CCATGCCTACCTGGAACTCCAGC No data
Right 1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG No data
1138693628_1138693633 -5 Left 1138693628 16:58791097-58791119 CCCATGCCTACCTGGAACTCCAG No data
Right 1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG No data
1138693624_1138693633 4 Left 1138693624 16:58791088-58791110 CCCACCAAGCCCATGCCTACCTG No data
Right 1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG No data
1138693622_1138693633 25 Left 1138693622 16:58791067-58791089 CCGGCTGTTCCGAGTGTGGAGCC No data
Right 1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG No data
1138693627_1138693633 0 Left 1138693627 16:58791092-58791114 CCAAGCCCATGCCTACCTGGAAC No data
Right 1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG No data
1138693625_1138693633 3 Left 1138693625 16:58791089-58791111 CCACCAAGCCCATGCCTACCTGG No data
Right 1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG No data
1138693623_1138693633 16 Left 1138693623 16:58791076-58791098 CCGAGTGTGGAGCCCACCAAGCC No data
Right 1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138693633 Original CRISPR TCCAGCTGGCCCAGAAGCGC CGG Intergenic
No off target data available for this crispr