ID: 1138699485

View in Genome Browser
Species Human (GRCh38)
Location 16:58846984-58847006
Sequence GGACTGTGCTGCTGCCATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2557
Summary {0: 73, 1: 841, 2: 430, 3: 172, 4: 1041}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138699485_1138699495 24 Left 1138699485 16:58846984-58847006 CCGAGATGGCAGCAGCACAGTCC 0: 73
1: 841
2: 430
3: 172
4: 1041
Right 1138699495 16:58847031-58847053 GACCGTGGAGGGAGAGGCAGAGG No data
1138699485_1138699488 -1 Left 1138699485 16:58846984-58847006 CCGAGATGGCAGCAGCACAGTCC 0: 73
1: 841
2: 430
3: 172
4: 1041
Right 1138699488 16:58847006-58847028 CAGCTTCGGCTCCGCATGAGAGG 0: 125
1: 118
2: 558
3: 550
4: 274
1138699485_1138699493 13 Left 1138699485 16:58846984-58847006 CCGAGATGGCAGCAGCACAGTCC 0: 73
1: 841
2: 430
3: 172
4: 1041
Right 1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG No data
1138699485_1138699496 25 Left 1138699485 16:58846984-58847006 CCGAGATGGCAGCAGCACAGTCC 0: 73
1: 841
2: 430
3: 172
4: 1041
Right 1138699496 16:58847032-58847054 ACCGTGGAGGGAGAGGCAGAGGG No data
1138699485_1138699489 0 Left 1138699485 16:58846984-58847006 CCGAGATGGCAGCAGCACAGTCC 0: 73
1: 841
2: 430
3: 172
4: 1041
Right 1138699489 16:58847007-58847029 AGCTTCGGCTCCGCATGAGAGGG 0: 125
1: 120
2: 546
3: 525
4: 281
1138699485_1138699494 18 Left 1138699485 16:58846984-58847006 CCGAGATGGCAGCAGCACAGTCC 0: 73
1: 841
2: 430
3: 172
4: 1041
Right 1138699494 16:58847025-58847047 GAGGGAGACCGTGGAGGGAGAGG 0: 43
1: 97
2: 781
3: 682
4: 920
1138699485_1138699490 9 Left 1138699485 16:58846984-58847006 CCGAGATGGCAGCAGCACAGTCC 0: 73
1: 841
2: 430
3: 172
4: 1041
Right 1138699490 16:58847016-58847038 TCCGCATGAGAGGGAGACCGTGG 0: 122
1: 132
2: 680
3: 482
4: 219
1138699485_1138699492 12 Left 1138699485 16:58846984-58847006 CCGAGATGGCAGCAGCACAGTCC 0: 73
1: 841
2: 430
3: 172
4: 1041
Right 1138699492 16:58847019-58847041 GCATGAGAGGGAGACCGTGGAGG No data
1138699485_1138699498 30 Left 1138699485 16:58846984-58847006 CCGAGATGGCAGCAGCACAGTCC 0: 73
1: 841
2: 430
3: 172
4: 1041
Right 1138699498 16:58847037-58847059 GGAGGGAGAGGCAGAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138699485 Original CRISPR GGACTGTGCTGCTGCCATCT CGG (reversed) Intergenic
Too many off-targets to display for this crispr