ID: 1138699493

View in Genome Browser
Species Human (GRCh38)
Location 16:58847020-58847042
Sequence CATGAGAGGGAGACCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138699485_1138699493 13 Left 1138699485 16:58846984-58847006 CCGAGATGGCAGCAGCACAGTCC 0: 73
1: 841
2: 430
3: 172
4: 1041
Right 1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG No data
1138699487_1138699493 -8 Left 1138699487 16:58847005-58847027 CCAGCTTCGGCTCCGCATGAGAG 0: 125
1: 119
2: 538
3: 536
4: 285
Right 1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138699493 Original CRISPR CATGAGAGGGAGACCGTGGA GGG Intergenic
No off target data available for this crispr