ID: 1138706936

View in Genome Browser
Species Human (GRCh38)
Location 16:58924792-58924814
Sequence GCTGTTGGGGAGGCAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138706936_1138706943 -7 Left 1138706936 16:58924792-58924814 CCCACTTCTGCCTCCCCAACAGC No data
Right 1138706943 16:58924808-58924830 CAACAGCCAATACTGGTCTTAGG No data
1138706936_1138706948 6 Left 1138706936 16:58924792-58924814 CCCACTTCTGCCTCCCCAACAGC No data
Right 1138706948 16:58924821-58924843 TGGTCTTAGGGGTCTAGGCCTGG No data
1138706936_1138706949 12 Left 1138706936 16:58924792-58924814 CCCACTTCTGCCTCCCCAACAGC No data
Right 1138706949 16:58924827-58924849 TAGGGGTCTAGGCCTGGAAGTGG No data
1138706936_1138706945 -5 Left 1138706936 16:58924792-58924814 CCCACTTCTGCCTCCCCAACAGC No data
Right 1138706945 16:58924810-58924832 ACAGCCAATACTGGTCTTAGGGG No data
1138706936_1138706944 -6 Left 1138706936 16:58924792-58924814 CCCACTTCTGCCTCCCCAACAGC No data
Right 1138706944 16:58924809-58924831 AACAGCCAATACTGGTCTTAGGG No data
1138706936_1138706947 1 Left 1138706936 16:58924792-58924814 CCCACTTCTGCCTCCCCAACAGC No data
Right 1138706947 16:58924816-58924838 AATACTGGTCTTAGGGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138706936 Original CRISPR GCTGTTGGGGAGGCAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr