ID: 1138708478

View in Genome Browser
Species Human (GRCh38)
Location 16:58942021-58942043
Sequence TGGGCTGCACAGCAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138708464_1138708478 20 Left 1138708464 16:58941978-58942000 CCCTAGGCCACCAACCAGTACTG No data
Right 1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG No data
1138708470_1138708478 6 Left 1138708470 16:58941992-58942014 CCAGTACTGGTCTGTGGCCTGTT 0: 45
1: 156
2: 346
3: 468
4: 735
Right 1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG No data
1138708460_1138708478 27 Left 1138708460 16:58941971-58941993 CCCCAACCCCTAGGCCACCAACC No data
Right 1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG No data
1138708467_1138708478 13 Left 1138708467 16:58941985-58942007 CCACCAACCAGTACTGGTCTGTG No data
Right 1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG No data
1138708463_1138708478 21 Left 1138708463 16:58941977-58941999 CCCCTAGGCCACCAACCAGTACT No data
Right 1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG No data
1138708461_1138708478 26 Left 1138708461 16:58941972-58941994 CCCAACCCCTAGGCCACCAACCA No data
Right 1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG No data
1138708469_1138708478 10 Left 1138708469 16:58941988-58942010 CCAACCAGTACTGGTCTGTGGCC No data
Right 1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG No data
1138708465_1138708478 19 Left 1138708465 16:58941979-58942001 CCTAGGCCACCAACCAGTACTGG No data
Right 1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG No data
1138708462_1138708478 25 Left 1138708462 16:58941973-58941995 CCAACCCCTAGGCCACCAACCAG No data
Right 1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138708478 Original CRISPR TGGGCTGCACAGCAGGAGGA GGG Intergenic
No off target data available for this crispr