ID: 1138715884

View in Genome Browser
Species Human (GRCh38)
Location 16:59021586-59021608
Sequence TTCCAATTGGACTTGGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138715884_1138715890 21 Left 1138715884 16:59021586-59021608 CCATTGGCCAAGTCCAATTGGAA No data
Right 1138715890 16:59021630-59021652 GTCCATGTACAGCAGCCTCTGGG No data
1138715884_1138715889 20 Left 1138715884 16:59021586-59021608 CCATTGGCCAAGTCCAATTGGAA No data
Right 1138715889 16:59021629-59021651 AGTCCATGTACAGCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138715884 Original CRISPR TTCCAATTGGACTTGGCCAA TGG (reversed) Intergenic
No off target data available for this crispr