ID: 1138715888

View in Genome Browser
Species Human (GRCh38)
Location 16:59021599-59021621
Sequence CTGATTCCCTTGCTTCCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138715888_1138715894 23 Left 1138715888 16:59021599-59021621 CCAATTGGAAGCAAGGGAATCAG No data
Right 1138715894 16:59021645-59021667 CCTCTGGGTGCAGAGCAGGTTGG No data
1138715888_1138715890 8 Left 1138715888 16:59021599-59021621 CCAATTGGAAGCAAGGGAATCAG No data
Right 1138715890 16:59021630-59021652 GTCCATGTACAGCAGCCTCTGGG No data
1138715888_1138715889 7 Left 1138715888 16:59021599-59021621 CCAATTGGAAGCAAGGGAATCAG No data
Right 1138715889 16:59021629-59021651 AGTCCATGTACAGCAGCCTCTGG No data
1138715888_1138715892 19 Left 1138715888 16:59021599-59021621 CCAATTGGAAGCAAGGGAATCAG No data
Right 1138715892 16:59021641-59021663 GCAGCCTCTGGGTGCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138715888 Original CRISPR CTGATTCCCTTGCTTCCAAT TGG (reversed) Intergenic
No off target data available for this crispr