ID: 1138715889

View in Genome Browser
Species Human (GRCh38)
Location 16:59021629-59021651
Sequence AGTCCATGTACAGCAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138715886_1138715889 13 Left 1138715886 16:59021593-59021615 CCAAGTCCAATTGGAAGCAAGGG No data
Right 1138715889 16:59021629-59021651 AGTCCATGTACAGCAGCCTCTGG No data
1138715884_1138715889 20 Left 1138715884 16:59021586-59021608 CCATTGGCCAAGTCCAATTGGAA No data
Right 1138715889 16:59021629-59021651 AGTCCATGTACAGCAGCCTCTGG No data
1138715888_1138715889 7 Left 1138715888 16:59021599-59021621 CCAATTGGAAGCAAGGGAATCAG No data
Right 1138715889 16:59021629-59021651 AGTCCATGTACAGCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138715889 Original CRISPR AGTCCATGTACAGCAGCCTC TGG Intergenic
No off target data available for this crispr