ID: 1138718733

View in Genome Browser
Species Human (GRCh38)
Location 16:59053772-59053794
Sequence CCTCTCCAGTATAAAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138718727_1138718733 8 Left 1138718727 16:59053741-59053763 CCACTTATATCCAGAGTGATTTC No data
Right 1138718733 16:59053772-59053794 CCTCTCCAGTATAAAGGCTGTGG No data
1138718728_1138718733 -2 Left 1138718728 16:59053751-59053773 CCAGAGTGATTTCTCTGAACCCC No data
Right 1138718733 16:59053772-59053794 CCTCTCCAGTATAAAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138718733 Original CRISPR CCTCTCCAGTATAAAGGCTG TGG Intergenic
No off target data available for this crispr