ID: 1138719071

View in Genome Browser
Species Human (GRCh38)
Location 16:59058265-59058287
Sequence TGAGGTCATAGGTACAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138719071_1138719083 28 Left 1138719071 16:59058265-59058287 CCCTGCCTGTACCTATGACCTCA No data
Right 1138719083 16:59058316-59058338 AGGAAGAGAAAACAGGGGCCTGG No data
1138719071_1138719081 22 Left 1138719071 16:59058265-59058287 CCCTGCCTGTACCTATGACCTCA No data
Right 1138719081 16:59058310-59058332 TGACAAAGGAAGAGAAAACAGGG No data
1138719071_1138719078 8 Left 1138719071 16:59058265-59058287 CCCTGCCTGTACCTATGACCTCA No data
Right 1138719078 16:59058296-59058318 TTCCTACAATCAGTTGACAAAGG No data
1138719071_1138719082 23 Left 1138719071 16:59058265-59058287 CCCTGCCTGTACCTATGACCTCA No data
Right 1138719082 16:59058311-59058333 GACAAAGGAAGAGAAAACAGGGG No data
1138719071_1138719080 21 Left 1138719071 16:59058265-59058287 CCCTGCCTGTACCTATGACCTCA No data
Right 1138719080 16:59058309-59058331 TTGACAAAGGAAGAGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138719071 Original CRISPR TGAGGTCATAGGTACAGGCA GGG (reversed) Intergenic