ID: 1138719075

View in Genome Browser
Species Human (GRCh38)
Location 16:59058270-59058292
Sequence TCCCATGAGGTCATAGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138719075_1138719078 3 Left 1138719075 16:59058270-59058292 CCTGTACCTATGACCTCATGGGA No data
Right 1138719078 16:59058296-59058318 TTCCTACAATCAGTTGACAAAGG No data
1138719075_1138719080 16 Left 1138719075 16:59058270-59058292 CCTGTACCTATGACCTCATGGGA No data
Right 1138719080 16:59058309-59058331 TTGACAAAGGAAGAGAAAACAGG No data
1138719075_1138719081 17 Left 1138719075 16:59058270-59058292 CCTGTACCTATGACCTCATGGGA No data
Right 1138719081 16:59058310-59058332 TGACAAAGGAAGAGAAAACAGGG No data
1138719075_1138719083 23 Left 1138719075 16:59058270-59058292 CCTGTACCTATGACCTCATGGGA No data
Right 1138719083 16:59058316-59058338 AGGAAGAGAAAACAGGGGCCTGG No data
1138719075_1138719082 18 Left 1138719075 16:59058270-59058292 CCTGTACCTATGACCTCATGGGA No data
Right 1138719082 16:59058311-59058333 GACAAAGGAAGAGAAAACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138719075 Original CRISPR TCCCATGAGGTCATAGGTAC AGG (reversed) Intergenic
No off target data available for this crispr