ID: 1138719076

View in Genome Browser
Species Human (GRCh38)
Location 16:59058276-59058298
Sequence GAAACTTCCCATGAGGTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138719076_1138719081 11 Left 1138719076 16:59058276-59058298 CCTATGACCTCATGGGAAGTTTC No data
Right 1138719081 16:59058310-59058332 TGACAAAGGAAGAGAAAACAGGG No data
1138719076_1138719084 28 Left 1138719076 16:59058276-59058298 CCTATGACCTCATGGGAAGTTTC No data
Right 1138719084 16:59058327-59058349 ACAGGGGCCTGGTTTACACATGG No data
1138719076_1138719080 10 Left 1138719076 16:59058276-59058298 CCTATGACCTCATGGGAAGTTTC No data
Right 1138719080 16:59058309-59058331 TTGACAAAGGAAGAGAAAACAGG No data
1138719076_1138719082 12 Left 1138719076 16:59058276-59058298 CCTATGACCTCATGGGAAGTTTC No data
Right 1138719082 16:59058311-59058333 GACAAAGGAAGAGAAAACAGGGG No data
1138719076_1138719083 17 Left 1138719076 16:59058276-59058298 CCTATGACCTCATGGGAAGTTTC No data
Right 1138719083 16:59058316-59058338 AGGAAGAGAAAACAGGGGCCTGG No data
1138719076_1138719078 -3 Left 1138719076 16:59058276-59058298 CCTATGACCTCATGGGAAGTTTC No data
Right 1138719078 16:59058296-59058318 TTCCTACAATCAGTTGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138719076 Original CRISPR GAAACTTCCCATGAGGTCAT AGG (reversed) Intergenic