ID: 1138719077

View in Genome Browser
Species Human (GRCh38)
Location 16:59058283-59058305
Sequence ATTGTAGGAAACTTCCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138719077_1138719078 -10 Left 1138719077 16:59058283-59058305 CCTCATGGGAAGTTTCCTACAAT No data
Right 1138719078 16:59058296-59058318 TTCCTACAATCAGTTGACAAAGG No data
1138719077_1138719081 4 Left 1138719077 16:59058283-59058305 CCTCATGGGAAGTTTCCTACAAT No data
Right 1138719081 16:59058310-59058332 TGACAAAGGAAGAGAAAACAGGG No data
1138719077_1138719084 21 Left 1138719077 16:59058283-59058305 CCTCATGGGAAGTTTCCTACAAT No data
Right 1138719084 16:59058327-59058349 ACAGGGGCCTGGTTTACACATGG No data
1138719077_1138719083 10 Left 1138719077 16:59058283-59058305 CCTCATGGGAAGTTTCCTACAAT No data
Right 1138719083 16:59058316-59058338 AGGAAGAGAAAACAGGGGCCTGG No data
1138719077_1138719085 26 Left 1138719077 16:59058283-59058305 CCTCATGGGAAGTTTCCTACAAT No data
Right 1138719085 16:59058332-59058354 GGCCTGGTTTACACATGGCCTGG No data
1138719077_1138719080 3 Left 1138719077 16:59058283-59058305 CCTCATGGGAAGTTTCCTACAAT No data
Right 1138719080 16:59058309-59058331 TTGACAAAGGAAGAGAAAACAGG No data
1138719077_1138719082 5 Left 1138719077 16:59058283-59058305 CCTCATGGGAAGTTTCCTACAAT No data
Right 1138719082 16:59058311-59058333 GACAAAGGAAGAGAAAACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138719077 Original CRISPR ATTGTAGGAAACTTCCCATG AGG (reversed) Intergenic