ID: 1138719079

View in Genome Browser
Species Human (GRCh38)
Location 16:59058298-59058320
Sequence TTCCTTTGTCAACTGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138719079_1138719084 6 Left 1138719079 16:59058298-59058320 CCTACAATCAGTTGACAAAGGAA No data
Right 1138719084 16:59058327-59058349 ACAGGGGCCTGGTTTACACATGG No data
1138719079_1138719085 11 Left 1138719079 16:59058298-59058320 CCTACAATCAGTTGACAAAGGAA No data
Right 1138719085 16:59058332-59058354 GGCCTGGTTTACACATGGCCTGG No data
1138719079_1138719082 -10 Left 1138719079 16:59058298-59058320 CCTACAATCAGTTGACAAAGGAA No data
Right 1138719082 16:59058311-59058333 GACAAAGGAAGAGAAAACAGGGG No data
1138719079_1138719083 -5 Left 1138719079 16:59058298-59058320 CCTACAATCAGTTGACAAAGGAA No data
Right 1138719083 16:59058316-59058338 AGGAAGAGAAAACAGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138719079 Original CRISPR TTCCTTTGTCAACTGATTGT AGG (reversed) Intergenic
No off target data available for this crispr