ID: 1138719081

View in Genome Browser
Species Human (GRCh38)
Location 16:59058310-59058332
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138719077_1138719081 4 Left 1138719077 16:59058283-59058305 CCTCATGGGAAGTTTCCTACAAT No data
Right 1138719081 16:59058310-59058332 TGACAAAGGAAGAGAAAACAGGG No data
1138719071_1138719081 22 Left 1138719071 16:59058265-59058287 CCCTGCCTGTACCTATGACCTCA No data
Right 1138719081 16:59058310-59058332 TGACAAAGGAAGAGAAAACAGGG No data
1138719072_1138719081 21 Left 1138719072 16:59058266-59058288 CCTGCCTGTACCTATGACCTCAT No data
Right 1138719081 16:59058310-59058332 TGACAAAGGAAGAGAAAACAGGG No data
1138719076_1138719081 11 Left 1138719076 16:59058276-59058298 CCTATGACCTCATGGGAAGTTTC No data
Right 1138719081 16:59058310-59058332 TGACAAAGGAAGAGAAAACAGGG No data
1138719075_1138719081 17 Left 1138719075 16:59058270-59058292 CCTGTACCTATGACCTCATGGGA No data
Right 1138719081 16:59058310-59058332 TGACAAAGGAAGAGAAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138719081 Original CRISPR TGACAAAGGAAGAGAAAACA GGG Intergenic