ID: 1138719085

View in Genome Browser
Species Human (GRCh38)
Location 16:59058332-59058354
Sequence GGCCTGGTTTACACATGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138719079_1138719085 11 Left 1138719079 16:59058298-59058320 CCTACAATCAGTTGACAAAGGAA No data
Right 1138719085 16:59058332-59058354 GGCCTGGTTTACACATGGCCTGG No data
1138719077_1138719085 26 Left 1138719077 16:59058283-59058305 CCTCATGGGAAGTTTCCTACAAT No data
Right 1138719085 16:59058332-59058354 GGCCTGGTTTACACATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138719085 Original CRISPR GGCCTGGTTTACACATGGCC TGG Intergenic