ID: 1138722155

View in Genome Browser
Species Human (GRCh38)
Location 16:59094882-59094904
Sequence CAGAAGAAACACAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138722151_1138722155 13 Left 1138722151 16:59094846-59094868 CCTACATTGATTTGACAGGCACT No data
Right 1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG No data
1138722149_1138722155 21 Left 1138722149 16:59094838-59094860 CCTTTAATCCTACATTGATTTGA No data
Right 1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138722155 Original CRISPR CAGAAGAAACACAAGGAGGG AGG Intergenic
No off target data available for this crispr