ID: 1138722243

View in Genome Browser
Species Human (GRCh38)
Location 16:59096167-59096189
Sequence TAGGATGATGAATATTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138722239_1138722243 24 Left 1138722239 16:59096120-59096142 CCATGTTTCTGAATTAACAGAGA No data
Right 1138722243 16:59096167-59096189 TAGGATGATGAATATTGACAAGG No data
1138722238_1138722243 25 Left 1138722238 16:59096119-59096141 CCCATGTTTCTGAATTAACAGAG No data
Right 1138722243 16:59096167-59096189 TAGGATGATGAATATTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138722243 Original CRISPR TAGGATGATGAATATTGACA AGG Intergenic
No off target data available for this crispr