ID: 1138725891

View in Genome Browser
Species Human (GRCh38)
Location 16:59138982-59139004
Sequence GAGGAAAGGCCTTTGCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138725891_1138725896 -2 Left 1138725891 16:59138982-59139004 CCCCTTAGCAAAGGCCTTTCCTC No data
Right 1138725896 16:59139003-59139025 TCACTCTTGTGCCTTTCTCCTGG No data
1138725891_1138725897 -1 Left 1138725891 16:59138982-59139004 CCCCTTAGCAAAGGCCTTTCCTC No data
Right 1138725897 16:59139004-59139026 CACTCTTGTGCCTTTCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138725891 Original CRISPR GAGGAAAGGCCTTTGCTAAG GGG (reversed) Intergenic
No off target data available for this crispr