ID: 1138726553

View in Genome Browser
Species Human (GRCh38)
Location 16:59146829-59146851
Sequence CAGATATTCTAGAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138726553_1138726559 -3 Left 1138726553 16:59146829-59146851 CCCACTGCCCTCTAGAATATCTG No data
Right 1138726559 16:59146849-59146871 CTGATTTTATTTTGTCCTTGGGG No data
1138726553_1138726564 19 Left 1138726553 16:59146829-59146851 CCCACTGCCCTCTAGAATATCTG No data
Right 1138726564 16:59146871-59146893 GTCATTGCTAAATGGTGGGAAGG No data
1138726553_1138726558 -4 Left 1138726553 16:59146829-59146851 CCCACTGCCCTCTAGAATATCTG No data
Right 1138726558 16:59146848-59146870 TCTGATTTTATTTTGTCCTTGGG No data
1138726553_1138726560 11 Left 1138726553 16:59146829-59146851 CCCACTGCCCTCTAGAATATCTG No data
Right 1138726560 16:59146863-59146885 TCCTTGGGGTCATTGCTAAATGG No data
1138726553_1138726557 -5 Left 1138726553 16:59146829-59146851 CCCACTGCCCTCTAGAATATCTG No data
Right 1138726557 16:59146847-59146869 ATCTGATTTTATTTTGTCCTTGG No data
1138726553_1138726562 14 Left 1138726553 16:59146829-59146851 CCCACTGCCCTCTAGAATATCTG No data
Right 1138726562 16:59146866-59146888 TTGGGGTCATTGCTAAATGGTGG No data
1138726553_1138726563 15 Left 1138726553 16:59146829-59146851 CCCACTGCCCTCTAGAATATCTG No data
Right 1138726563 16:59146867-59146889 TGGGGTCATTGCTAAATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138726553 Original CRISPR CAGATATTCTAGAGGGCAGT GGG (reversed) Intergenic
No off target data available for this crispr