ID: 1138729405

View in Genome Browser
Species Human (GRCh38)
Location 16:59178164-59178186
Sequence TCCCAAAGGGTGCTACAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138729400_1138729405 -2 Left 1138729400 16:59178143-59178165 CCCTAGACTCAAAATACCATGTC No data
Right 1138729405 16:59178164-59178186 TCCCAAAGGGTGCTACAGATAGG No data
1138729401_1138729405 -3 Left 1138729401 16:59178144-59178166 CCTAGACTCAAAATACCATGTCC No data
Right 1138729405 16:59178164-59178186 TCCCAAAGGGTGCTACAGATAGG No data
1138729399_1138729405 4 Left 1138729399 16:59178137-59178159 CCAGTGCCCTAGACTCAAAATAC No data
Right 1138729405 16:59178164-59178186 TCCCAAAGGGTGCTACAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138729405 Original CRISPR TCCCAAAGGGTGCTACAGAT AGG Intergenic
No off target data available for this crispr