ID: 1138730422

View in Genome Browser
Species Human (GRCh38)
Location 16:59187992-59188014
Sequence AATTAAGCAGAGACGATGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138730418_1138730422 11 Left 1138730418 16:59187958-59187980 CCACAAAGACAGCACGTATAAAG No data
Right 1138730422 16:59187992-59188014 AATTAAGCAGAGACGATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138730422 Original CRISPR AATTAAGCAGAGACGATGAT AGG Intergenic
No off target data available for this crispr