ID: 1138732243

View in Genome Browser
Species Human (GRCh38)
Location 16:59208192-59208214
Sequence GATAAGATGGTTAAAATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138732243_1138732246 28 Left 1138732243 16:59208192-59208214 CCATGAATTTTAACCATCTTATC No data
Right 1138732246 16:59208243-59208265 AGCCTCTCAATGTACATGAGAGG No data
1138732243_1138732247 29 Left 1138732243 16:59208192-59208214 CCATGAATTTTAACCATCTTATC No data
Right 1138732247 16:59208244-59208266 GCCTCTCAATGTACATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138732243 Original CRISPR GATAAGATGGTTAAAATTCA TGG (reversed) Intergenic
No off target data available for this crispr