ID: 1138732245

View in Genome Browser
Species Human (GRCh38)
Location 16:59208205-59208227
Sequence TATCCTCATTTAAGATAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138732245_1138732247 16 Left 1138732245 16:59208205-59208227 CCATCTTATCTTAAATGAGGATA No data
Right 1138732247 16:59208244-59208266 GCCTCTCAATGTACATGAGAGGG No data
1138732245_1138732246 15 Left 1138732245 16:59208205-59208227 CCATCTTATCTTAAATGAGGATA No data
Right 1138732246 16:59208243-59208265 AGCCTCTCAATGTACATGAGAGG No data
1138732245_1138732249 26 Left 1138732245 16:59208205-59208227 CCATCTTATCTTAAATGAGGATA No data
Right 1138732249 16:59208254-59208276 GTACATGAGAGGGATCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138732245 Original CRISPR TATCCTCATTTAAGATAAGA TGG (reversed) Intergenic
No off target data available for this crispr