ID: 1138737436

View in Genome Browser
Species Human (GRCh38)
Location 16:59266625-59266647
Sequence CCTACTAAGTAGATGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138737432_1138737436 13 Left 1138737432 16:59266589-59266611 CCACTCACACACATAATACAAGG No data
Right 1138737436 16:59266625-59266647 CCTACTAAGTAGATGAAAGATGG No data
1138737430_1138737436 19 Left 1138737430 16:59266583-59266605 CCAGACCCACTCACACACATAAT No data
Right 1138737436 16:59266625-59266647 CCTACTAAGTAGATGAAAGATGG No data
1138737431_1138737436 14 Left 1138737431 16:59266588-59266610 CCCACTCACACACATAATACAAG No data
Right 1138737436 16:59266625-59266647 CCTACTAAGTAGATGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138737436 Original CRISPR CCTACTAAGTAGATGAAAGA TGG Intergenic
No off target data available for this crispr