ID: 1138737604

View in Genome Browser
Species Human (GRCh38)
Location 16:59268987-59269009
Sequence CAGTTTAACACCAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138737604_1138737614 27 Left 1138737604 16:59268987-59269009 CCTTCCTCATTGGTGTTAAACTG No data
Right 1138737614 16:59269037-59269059 GTTCTACTAAACTCTGGACAGGG No data
1138737604_1138737613 26 Left 1138737604 16:59268987-59269009 CCTTCCTCATTGGTGTTAAACTG No data
Right 1138737613 16:59269036-59269058 AGTTCTACTAAACTCTGGACAGG No data
1138737604_1138737611 21 Left 1138737604 16:59268987-59269009 CCTTCCTCATTGGTGTTAAACTG No data
Right 1138737611 16:59269031-59269053 CCCTCAGTTCTACTAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138737604 Original CRISPR CAGTTTAACACCAATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr