ID: 1138738558

View in Genome Browser
Species Human (GRCh38)
Location 16:59280548-59280570
Sequence CTATAGCAGAAGTGGCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138738558_1138738564 10 Left 1138738558 16:59280548-59280570 CCCAAGAGCCACTTCTGCTATAG No data
Right 1138738564 16:59280581-59280603 TGCTGCTGCCTCCAGCAGCAGGG No data
1138738558_1138738563 9 Left 1138738558 16:59280548-59280570 CCCAAGAGCCACTTCTGCTATAG No data
Right 1138738563 16:59280580-59280602 CTGCTGCTGCCTCCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138738558 Original CRISPR CTATAGCAGAAGTGGCTCTT GGG (reversed) Intergenic
No off target data available for this crispr