ID: 1138746506

View in Genome Browser
Species Human (GRCh38)
Location 16:59368775-59368797
Sequence CTCCTGTCATTGCACAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138746502_1138746506 17 Left 1138746502 16:59368735-59368757 CCGGGATGTGCTTGGCTTCTAGG No data
Right 1138746506 16:59368775-59368797 CTCCTGTCATTGCACAACCCTGG No data
1138746501_1138746506 18 Left 1138746501 16:59368734-59368756 CCCGGGATGTGCTTGGCTTCTAG No data
Right 1138746506 16:59368775-59368797 CTCCTGTCATTGCACAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138746506 Original CRISPR CTCCTGTCATTGCACAACCC TGG Intergenic
No off target data available for this crispr