ID: 1138747210

View in Genome Browser
Species Human (GRCh38)
Location 16:59377138-59377160
Sequence GACTTTGAATAGTGGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138747210_1138747213 7 Left 1138747210 16:59377138-59377160 CCTTCTCTCCACTATTCAAAGTC No data
Right 1138747213 16:59377168-59377190 TGTTTTAAACATATTGTCCAGGG No data
1138747210_1138747212 6 Left 1138747210 16:59377138-59377160 CCTTCTCTCCACTATTCAAAGTC No data
Right 1138747212 16:59377167-59377189 TTGTTTTAAACATATTGTCCAGG No data
1138747210_1138747214 17 Left 1138747210 16:59377138-59377160 CCTTCTCTCCACTATTCAAAGTC No data
Right 1138747214 16:59377178-59377200 ATATTGTCCAGGGTCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138747210 Original CRISPR GACTTTGAATAGTGGAGAGA AGG (reversed) Intergenic
No off target data available for this crispr