ID: 1138747210 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:59377138-59377160 |
Sequence | GACTTTGAATAGTGGAGAGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1138747210_1138747213 | 7 | Left | 1138747210 | 16:59377138-59377160 | CCTTCTCTCCACTATTCAAAGTC | No data | ||
Right | 1138747213 | 16:59377168-59377190 | TGTTTTAAACATATTGTCCAGGG | No data | ||||
1138747210_1138747212 | 6 | Left | 1138747210 | 16:59377138-59377160 | CCTTCTCTCCACTATTCAAAGTC | No data | ||
Right | 1138747212 | 16:59377167-59377189 | TTGTTTTAAACATATTGTCCAGG | No data | ||||
1138747210_1138747214 | 17 | Left | 1138747210 | 16:59377138-59377160 | CCTTCTCTCCACTATTCAAAGTC | No data | ||
Right | 1138747214 | 16:59377178-59377200 | ATATTGTCCAGGGTCAGTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1138747210 | Original CRISPR | GACTTTGAATAGTGGAGAGA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |