ID: 1138747213

View in Genome Browser
Species Human (GRCh38)
Location 16:59377168-59377190
Sequence TGTTTTAAACATATTGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138747210_1138747213 7 Left 1138747210 16:59377138-59377160 CCTTCTCTCCACTATTCAAAGTC No data
Right 1138747213 16:59377168-59377190 TGTTTTAAACATATTGTCCAGGG No data
1138747209_1138747213 10 Left 1138747209 16:59377135-59377157 CCTCCTTCTCTCCACTATTCAAA No data
Right 1138747213 16:59377168-59377190 TGTTTTAAACATATTGTCCAGGG No data
1138747211_1138747213 -1 Left 1138747211 16:59377146-59377168 CCACTATTCAAAGTCTTCTGTTT No data
Right 1138747213 16:59377168-59377190 TGTTTTAAACATATTGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138747213 Original CRISPR TGTTTTAAACATATTGTCCA GGG Intergenic
No off target data available for this crispr