ID: 1138747214

View in Genome Browser
Species Human (GRCh38)
Location 16:59377178-59377200
Sequence ATATTGTCCAGGGTCAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138747211_1138747214 9 Left 1138747211 16:59377146-59377168 CCACTATTCAAAGTCTTCTGTTT No data
Right 1138747214 16:59377178-59377200 ATATTGTCCAGGGTCAGTCCAGG No data
1138747209_1138747214 20 Left 1138747209 16:59377135-59377157 CCTCCTTCTCTCCACTATTCAAA No data
Right 1138747214 16:59377178-59377200 ATATTGTCCAGGGTCAGTCCAGG No data
1138747210_1138747214 17 Left 1138747210 16:59377138-59377160 CCTTCTCTCCACTATTCAAAGTC No data
Right 1138747214 16:59377178-59377200 ATATTGTCCAGGGTCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138747214 Original CRISPR ATATTGTCCAGGGTCAGTCC AGG Intergenic
No off target data available for this crispr