ID: 1138748934

View in Genome Browser
Species Human (GRCh38)
Location 16:59395599-59395621
Sequence GATTTAGTAGGTTTGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138748930_1138748934 -2 Left 1138748930 16:59395578-59395600 CCTTGGGAAAAGGCAGATTCTGA No data
Right 1138748934 16:59395599-59395621 GATTTAGTAGGTTTGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138748934 Original CRISPR GATTTAGTAGGTTTGGTGGC AGG Intergenic
No off target data available for this crispr