ID: 1138754276

View in Genome Browser
Species Human (GRCh38)
Location 16:59464463-59464485
Sequence CTTCTGTGCAACTGTAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138754276_1138754281 -7 Left 1138754276 16:59464463-59464485 CCTAGTTTACAGTTGCACAGAAG No data
Right 1138754281 16:59464479-59464501 ACAGAAGGTTTGGTACCATGGGG No data
1138754276_1138754279 -9 Left 1138754276 16:59464463-59464485 CCTAGTTTACAGTTGCACAGAAG No data
Right 1138754279 16:59464477-59464499 GCACAGAAGGTTTGGTACCATGG No data
1138754276_1138754282 -6 Left 1138754276 16:59464463-59464485 CCTAGTTTACAGTTGCACAGAAG No data
Right 1138754282 16:59464480-59464502 CAGAAGGTTTGGTACCATGGGGG No data
1138754276_1138754286 11 Left 1138754276 16:59464463-59464485 CCTAGTTTACAGTTGCACAGAAG No data
Right 1138754286 16:59464497-59464519 TGGGGGACTCGGCATTATGTGGG No data
1138754276_1138754280 -8 Left 1138754276 16:59464463-59464485 CCTAGTTTACAGTTGCACAGAAG No data
Right 1138754280 16:59464478-59464500 CACAGAAGGTTTGGTACCATGGG No data
1138754276_1138754285 10 Left 1138754276 16:59464463-59464485 CCTAGTTTACAGTTGCACAGAAG No data
Right 1138754285 16:59464496-59464518 ATGGGGGACTCGGCATTATGTGG No data
1138754276_1138754283 0 Left 1138754276 16:59464463-59464485 CCTAGTTTACAGTTGCACAGAAG No data
Right 1138754283 16:59464486-59464508 GTTTGGTACCATGGGGGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138754276 Original CRISPR CTTCTGTGCAACTGTAAACT AGG (reversed) Intergenic
No off target data available for this crispr