ID: 1138754286

View in Genome Browser
Species Human (GRCh38)
Location 16:59464497-59464519
Sequence TGGGGGACTCGGCATTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138754276_1138754286 11 Left 1138754276 16:59464463-59464485 CCTAGTTTACAGTTGCACAGAAG No data
Right 1138754286 16:59464497-59464519 TGGGGGACTCGGCATTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138754286 Original CRISPR TGGGGGACTCGGCATTATGT GGG Intergenic
No off target data available for this crispr