ID: 1138765128

View in Genome Browser
Species Human (GRCh38)
Location 16:59592802-59592824
Sequence CTGCAGGTCTTGAATAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138765128_1138765130 -9 Left 1138765128 16:59592802-59592824 CCATCATTATTCAAGACCTGCAG No data
Right 1138765130 16:59592816-59592838 GACCTGCAGGAAATATATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138765128 Original CRISPR CTGCAGGTCTTGAATAATGA TGG (reversed) Intergenic
No off target data available for this crispr