ID: 1138765716

View in Genome Browser
Species Human (GRCh38)
Location 16:59600767-59600789
Sequence CTTGAGCTAGGTGATTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138765716_1138765719 23 Left 1138765716 16:59600767-59600789 CCTTTAAAATCACCTAGCTCAAG No data
Right 1138765719 16:59600813-59600835 GTTTACCGAGTAACTACTGTGGG No data
1138765716_1138765718 22 Left 1138765716 16:59600767-59600789 CCTTTAAAATCACCTAGCTCAAG No data
Right 1138765718 16:59600812-59600834 TGTTTACCGAGTAACTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138765716 Original CRISPR CTTGAGCTAGGTGATTTTAA AGG (reversed) Intergenic
No off target data available for this crispr